RchiOBHm_Chr1g0362541

U4 U6.U5 tri-snRNP-associated protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
54169609 .. 54170052
444 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 279 bp
ATGCCCCTTATAAGCATCACATGTTTTTTATTTATTAGATGTCTTCGTTTTAATGTAACAGATGGCGATATGCTTGAGAATGTGGAACTTGGTGAGCAGAAGCAGCGAGATGACGCTTACAAGGCAGCAAAGAAAAAAACAGGGATTTATGCTGATAAGTTTAACGATGATCCTACTTTAGAGAAGAAAATTCTTCCACAATATGATGATCCTGCTGCAGATGAGGTCAGTATTTCTTGTCTGTTTCCCCCACTTTTAGTTTCTGCAGCCGAGTTTTAA

Protein Analysis

92

Amino Acids

10.39

Weight (kDa)

4.57

Isoelectric Point (pI)

38.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SART-1 PF03343 21 - 71 1e-05 SART-1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 11
AclWI GGATC 2 cut(s) 164, 203
AcsI RAATTY 1 cut(s) 189
AflIII ACRYGT 1 cut(s) 20
AlwI GGATC 2 cut(s) 164, 203
ApeKI GCWGC 4 cut(s) 103, 125, 215, 266
ApoI RAATTY 1 cut(s) 189
AsuHPI GGTGA 1 cut(s) 104
BbsI GAAGAC 1 cut(s) 35
BbvI GCAGC 3 cut(s) 115, 137, 202
BccI CCATC 1 cut(s) 56
BfmI CTRYAG 2 cut(s) 216, 264
BisI GCNGC 4 cut(s) 104, 126, 216, 267
BlsI GCNGC 4 cut(s) 105, 127, 217, 268
BmsI GCATC 1 cut(s) 24
BpiI GAAGAC 1 cut(s) 35
BpuEI CTTGAG 1 cut(s) 95
BseXI GCAGC 3 cut(s) 115, 137, 202
Bsp143I GATC 2 cut(s) 169, 208
BspMAI CTGCAG 2 cut(s) 220, 268
BspPI GGATC 2 cut(s) 164, 203
BssMI GATC 2 cut(s) 169, 208
BstKTI GATC 2 cut(s) 172, 211
BstMBI GATC 2 cut(s) 169, 208
BstMWI GCNNNNNNNGC 2 cut(s) 103, 122
BstNSI RCATGY 1 cut(s) 24
BstSFI CTRYAG 2 cut(s) 216, 264
BstV1I GCAGC 3 cut(s) 115, 137, 202
BstV2I GAAGAC 1 cut(s) 35
CseI GACGC 1 cut(s) 122
CviAII CATG 1 cut(s) 21
CviJI RGCY 1 cut(s) 269
CviKI_1 RGCY 1 cut(s) 269
DpnI GATC 2 cut(s) 171, 210
DpnII GATC 2 cut(s) 169, 208
FaeI CATG 1 cut(s) 24
FaiI YATR 5 cut(s) 11, 22, 71, 150, 204
FatI CATG 1 cut(s) 20
Fnu4HI GCNGC 4 cut(s) 104, 126, 216, 267
Fsp4HI GCNGC 4 cut(s) 104, 126, 216, 267
GluI GCNGC 4 cut(s) 104, 126, 216, 267
HgaI GACGC 1 cut(s) 122
Hin1II CATG 1 cut(s) 24
HphI GGTGA 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 218, 266
HpyF10VI GCNNNNNNNGC 2 cut(s) 103, 122
Hsp92II CATG 1 cut(s) 24
Kzo9I GATC 2 cut(s) 169, 208
LpnPI CCDG 2 cut(s) 126, 225
Lsp1109I GCAGC 3 cut(s) 115, 137, 202
LweI GCATC 1 cut(s) 24
MaeIII GTNAC 1 cut(s) 55
MalI GATC 2 cut(s) 171, 210
MboI GATC 2 cut(s) 169, 208
MboII GAAGA 3 cut(s) 35, 185, 196
MluCI AATT 1 cut(s) 189
MnlI CCTC 1 cut(s) 217
MseI TTAA 3 cut(s) 51, 162, 277
MwoI GCNNNNNNNGC 2 cut(s) 103, 122
NdeII GATC 2 cut(s) 169, 208
NlaIII CATG 1 cut(s) 24
NspI RCATGY 1 cut(s) 24
PciI ACATGT 1 cut(s) 20
PkrI GCNGC 4 cut(s) 105, 127, 217, 268
PscI ACATGT 1 cut(s) 20
PsiI TTATAA 1 cut(s) 11
PstI CTGCAG 2 cut(s) 220, 268
SaqAI TTAA 3 cut(s) 51, 162, 277
SatI GCNGC 4 cut(s) 104, 126, 216, 267
Sau3AI GATC 2 cut(s) 169, 208
SetI ASST 1 cut(s) 228
SfaNI GCATC 1 cut(s) 24
SfcI CTRYAG 2 cut(s) 216, 264
SgeI CNNG 8 cut(s) 33, 86, 101, 119, 133, 153, 224, 249
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 189
TasI AATT 1 cut(s) 189
Tru1I TTAA 3 cut(s) 51, 162, 277
Tru9I TTAA 3 cut(s) 51, 162, 277
TseI GCWGC 4 cut(s) 103, 125, 215, 266
XapI RAATTY 1 cut(s) 189
XceI RCATGY 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.