Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

55829094 .. 55829712

Gene Structure 619 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGAAGATGATTGCACCAAGGAGGATCCACTGTCACAGGAAGGTTTCCGCCCTGGAAGAAATGGCCAAGAAGAATGATGGGAAAATTACTTGTCCGAGGACAGGTGAGGTCTACAACTACAAAGATCTGGTGAAGGCATATATATCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0006508 GO:0006511 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009987 GO:0010498 GO:0019538 GO:0019941 GO:0030163 GO:0032991 GO:0034657 GO:0043161 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043632 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0051603 GO:0071704 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko03015 map03015

Pfam Domains

Protein Families

CLTH

Protein Analysis

49

Amino Acids

5.69

Weight (kDa)

9.7

Isoelectric Point (pI)

40.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	111
AciI	CCGC	1 cut(s)	48
AclWI	GGATC	2 cut(s)	19, 32
AcoI	YGGCCR	1 cut(s)	63
AfiI	CCNNNNNNNGG	1 cut(s)	101
AjnI	CCWGG	1 cut(s)	51
AlwI	GGATC	2 cut(s)	19, 32
AoxI	GGCC	1 cut(s)	63
AsuHPI	GGTGA	2 cut(s)	116, 142
BalI	TGGCCA	1 cut(s)	65
BamHI	GGATCC	1 cut(s)	24
BccI	CCATC	1 cut(s)	71
BciT130I	CCWGG	1 cut(s)	53
BglII	AGATCT	1 cut(s)	124
Bme1390I	CCNGG	1 cut(s)	53
BmiI	GGNNCC	1 cut(s)	26
BmrFI	CCNGG	1 cut(s)	53
BsaJI	CCNNGG	3 cut(s)	17, 51, 95
Bsc4I	CCNNNNNNNGG	1 cut(s)	101
BseBI	CCWGG	1 cut(s)	53
BseDI	CCNNGG	3 cut(s)	17, 51, 95
BseLI	CCNNNNNNNGG	1 cut(s)	101
BshFI	GGCC	1 cut(s)	65
BslI	CCNNNNNNNGG	1 cut(s)	101
BsnI	GGCC	1 cut(s)	65
Bsp143I	GATC	2 cut(s)	24, 124
BspACI	CCGC	1 cut(s)	48
BspANI	GGCC	1 cut(s)	65
BspHI	TCATGA	1 cut(s)	146
BspLI	GGNNCC	1 cut(s)	26
BspPI	GGATC	2 cut(s)	19, 32
BssECI	CCNNGG	3 cut(s)	17, 51, 95
BssMI	GATC	2 cut(s)	24, 124
BssT1I	CCWWGG	1 cut(s)	17
Bst2UI	CCWGG	1 cut(s)	53
Bst4CI	ACNGT	1 cut(s)	32
BstKTI	GATC	2 cut(s)	27, 127
BstMBI	GATC	2 cut(s)	24, 124
BstNI	CCWGG	1 cut(s)	53
BstSCI	CCNGG	1 cut(s)	51
BstX2I	RGATCY	2 cut(s)	24, 124
BstYI	RGATCY	2 cut(s)	24, 124
BsuRI	GGCC	1 cut(s)	65
BtsIMutI	CAGTG	1 cut(s)	28
CciI	TCATGA	1 cut(s)	146
CviAII	CATG	1 cut(s)	147
CviJI	RGCY	1 cut(s)	65
CviKI_1	RGCY	1 cut(s)	65
DpnI	GATC	2 cut(s)	26, 126
DpnII	GATC	2 cut(s)	24, 124
EaeI	YGGCCR	1 cut(s)	63
EciI	GGCGGA	1 cut(s)	37
Eco130I	CCWWGG	1 cut(s)	17
EcoRII	CCWGG	1 cut(s)	51
EcoT14I	CCWWGG	1 cut(s)	17
ErhI	CCWWGG	1 cut(s)	17
FaeI	CATG	1 cut(s)	150
FaiI	YATR	4 cut(s)	139, 141, 143, 148
FatI	CATG	1 cut(s)	146
FblI	GTMKAC	1 cut(s)	111
HaeIII	GGCC	1 cut(s)	65
Hin1II	CATG	1 cut(s)	150
HphI	GGTGA	2 cut(s)	116, 142
Hpy166II	GTNNAC	1 cut(s)	112
Hpy188I	TCNGA	1 cut(s)	96
Hpy188III	TCNNGA	1 cut(s)	147
Hpy8I	GTNNAC	1 cut(s)	112
HpyAV	CCTTC	2 cut(s)	34, 127
HpyCH4III	ACNGT	1 cut(s)	32
HpyCH4V	TGCA	1 cut(s)	14
Hsp92II	CATG	1 cut(s)	150
Kzo9I	GATC	2 cut(s)	24, 124
LpnPI	CCDG	5 cut(s)	22, 38, 65, 87, 113
MaeIII	GTNAC	1 cut(s)	32
MalI	GATC	2 cut(s)	26, 126
MboI	GATC	2 cut(s)	24, 124
MboII	GAAGA	3 cut(s)	16, 68, 82
MflI	RGATCY	2 cut(s)	24, 124
MlsI	TGGCCA	1 cut(s)	65
MluCI	AATT	1 cut(s)	84
MluNI	TGGCCA	1 cut(s)	65
MnlI	CCTC	3 cut(s)	15, 90, 100
Mox20I	TGGCCA	1 cut(s)	65
MscI	TGGCCA	1 cut(s)	65
Msp20I	TGGCCA	1 cut(s)	65
MspR9I	CCNGG	1 cut(s)	53
MvaI	CCWGG	1 cut(s)	53
NdeII	GATC	2 cut(s)	24, 124
NlaIII	CATG	1 cut(s)	150
NlaIV	GGNNCC	1 cut(s)	26
NmuCI	GTSAC	1 cut(s)	32
PagI	TCATGA	1 cut(s)	146
Psp6I	CCWGG	1 cut(s)	51
PspGI	CCWGG	1 cut(s)	51
PspN4I	GGNNCC	1 cut(s)	26
PsuI	RGATCY	2 cut(s)	24, 124
Sau3AI	GATC	2 cut(s)	24, 124
ScrFI	CCNGG	1 cut(s)	53
SetI	ASST	3 cut(s)	45, 106, 111
SgeI	CNNG	9 cut(s)	30, 49, 64, 65, 79, 102, 108, 114, 140
Sse9I	AATT	1 cut(s)	84
SsiI	CCGC	1 cut(s)	48
StyD4I	CCNGG	1 cut(s)	51
StyI	CCWWGG	1 cut(s)	17
TaaI	ACNGT	1 cut(s)	32
TasI	AATT	1 cut(s)	84
TscAI	CASTG	1 cut(s)	35
TseFI	GTSAC	1 cut(s)	32
Tsp45I	GTSAC	1 cut(s)	32
TspDTI	ATGAA	1 cut(s)	17
TspRI	CASTG	1 cut(s)	35
XmiI	GTMKAC	1 cut(s)	111

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.