RchiOBHm_Chr1g0366151

39S ribosomal protein L46

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
56830653 .. 56832198
1546 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGGAGTTATCAGAGAATTTTACCTATTCTCACTCTCCATCTTTTAAGCAATTCCTTCTTAAGTCTCAAGTGAATGCGATGAAGAAGTTAAAAATTGGGAAGTGTGAGGATTTTGTTTGGGTGACCAAGGATGGATTGATGGAATGTTTTCCCGATCTTGAAGATTCATTTTGTGAATATGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.14

Weight (kDa)

4.91

Isoelectric Point (pI)

34.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 16
AflII CTTAAG 1 cut(s) 59
AgsI TTSAA 1 cut(s) 161
Alw26I GTCTC 1 cut(s) 69
ApoI RAATTY 1 cut(s) 16
Asp700I GAANNNNTTC 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 133
BccI CCATC 3 cut(s) 46, 125, 133
BcoDI GTCTC 1 cut(s) 69
BfaI CTAG 1 cut(s) 184
BfrI CTTAAG 1 cut(s) 59
BpuEI CTTGAG 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 126
BseGI GGATG 1 cut(s) 136
BsmAI GTCTC 1 cut(s) 69
BsmI GAATGC 1 cut(s) 79
Bsp143I GATC 1 cut(s) 154
BspTI CTTAAG 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 126
BssMI GATC 1 cut(s) 154
BssT1I CCWWGG 1 cut(s) 126
BstAFI CTTAAG 1 cut(s) 59
BstEII GGTNACC 1 cut(s) 121
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 1 cut(s) 157
BstMAI GTCTC 1 cut(s) 69
BstMBI GATC 1 cut(s) 154
BstPI GGTNACC 1 cut(s) 121
BtgZI GCGATG 1 cut(s) 92
BtsCI GGATG 1 cut(s) 136
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Eco130I CCWWGG 1 cut(s) 126
Eco91I GGTNACC 1 cut(s) 121
EcoO65I GGTNACC 1 cut(s) 121
EcoT14I CCWWGG 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 126
FaiI YATR 1 cut(s) 180
FokI GGATG 1 cut(s) 143
FspBI CTAG 1 cut(s) 184
HinfI GANTC 1 cut(s) 164
HphI GGTGA 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 13
Hpy188III TCNNGA 2 cut(s) 152, 158
HpyAV CCTTC 1 cut(s) 65
Kzo9I GATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 184
MaeIII GTNAC 1 cut(s) 121
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 2 cut(s) 94, 173
MluCI AATT 3 cut(s) 16, 50, 93
MnlI CCTC 1 cut(s) 100
MroXI GAANNNNTTC 1 cut(s) 147
MseI TTAA 3 cut(s) 45, 60, 89
MspCI CTTAAG 1 cut(s) 59
Mva1269I GAATGC 1 cut(s) 79
NdeII GATC 1 cut(s) 154
NmuCI GTSAC 1 cut(s) 121
PctI GAATGC 1 cut(s) 79
PdmI GAANNNNTTC 1 cut(s) 147
PfeI GAWTC 1 cut(s) 164
PspEI GGTNACC 1 cut(s) 121
SaqAI TTAA 3 cut(s) 45, 60, 89
Sau3AI GATC 1 cut(s) 154
SetI ASST 1 cut(s) 26
SgeI CNNG 4 cut(s) 80, 139, 164, 170
SmlI CTYRAG 2 cut(s) 59, 66
SmoI CTYRAG 2 cut(s) 59, 66
Sse9I AATT 3 cut(s) 16, 50, 93
SspMI CTAG 1 cut(s) 184
StyI CCWWGG 1 cut(s) 126
TasI AATT 3 cut(s) 16, 50, 93
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 3 cut(s) 45, 60, 89
Tru9I TTAA 3 cut(s) 45, 60, 89
TseFI GTSAC 1 cut(s) 121
Tsp45I GTSAC 1 cut(s) 121
TspDTI ATGAA 2 cut(s) 95, 156
Vha464I CTTAAG 1 cut(s) 59
XapI RAATTY 1 cut(s) 16
XmnI GAANNNNTTC 1 cut(s) 147
XspI CTAG 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.