RchiOBHm_Chr1g0367501

Domain of unknown function (DUF3475)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
57809247 .. 57809435
189 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGGCAGATGCAGAAACCAAAGATTCTGATCACATTAGTCCTAGTCCATCAATTTTCAGCAAGTACAAGCTGTTGGATGCTCCACCCGACACACTCGGTGCTGCTGCCTTAGCACTGCACTATGCAAATATTGTTATCAAATTAAAATTGAAAGTTAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.71

Weight (kDa)

8.05

Isoelectric Point (pI)

55.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 98
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
ApeKI GCWGC 2 cut(s) 101, 104
BbvI GCAGC 2 cut(s) 88, 91
BccI CCATC 1 cut(s) 55
BclI TGATCA 1 cut(s) 28
BfaI CTAG 1 cut(s) 42
BisI GCNGC 2 cut(s) 102, 105
BlsI GCNGC 2 cut(s) 103, 106
BmsI GCATC 1 cut(s) 67
Bpu10I CCTNAGC 1 cut(s) 109
BsaBI GATNNNNATC 1 cut(s) 27
Bse8I GATNNNNATC 1 cut(s) 27
BseGI GGATG 1 cut(s) 82
BseJI GATNNNNATC 1 cut(s) 27
BseXI GCAGC 2 cut(s) 88, 91
BsgI GTGCAG 1 cut(s) 101
Bsp143I GATC 1 cut(s) 28
BssMI GATC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 109
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstV1I GCAGC 2 cut(s) 88, 91
BtsCI GGATG 1 cut(s) 82
BtsI GCAGTG 1 cut(s) 113
BtsIMutI CAGTG 1 cut(s) 113
Csp6I GTAC 1 cut(s) 64
CviJI RGCY 1 cut(s) 70
CviKI_1 RGCY 1 cut(s) 70
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 1 cut(s) 109
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
DraIII CACNNNGTG 1 cut(s) 98
FaiI YATR 1 cut(s) 123
FbaI TGATCA 1 cut(s) 28
Fnu4HI GCNGC 2 cut(s) 102, 105
FokI GGATG 1 cut(s) 89
Fsp4HI GCNGC 2 cut(s) 102, 105
FspBI CTAG 1 cut(s) 42
FspEI CC 9 cut(s) 31, 54, 59, 60, 81, 96, 99, 100, 121
GluI GCNGC 2 cut(s) 102, 105
HinfI GANTC 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 28
HpyCH4V TGCA 3 cut(s) 11, 118, 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
HpyF3I CTNAG 1 cut(s) 109
Ksp22I TGATCA 1 cut(s) 28
Kzo9I GATC 1 cut(s) 28
LmnI GCTCC 1 cut(s) 85
Lsp1109I GCAGC 2 cut(s) 88, 91
LweI GCATC 1 cut(s) 67
MaeI CTAG 1 cut(s) 42
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MluCI AATT 3 cut(s) 51, 140, 146
MmeI TCCRAC 1 cut(s) 54
MseI TTAA 2 cut(s) 143, 156
MwoI GCNNNNNNNGC 1 cut(s) 110
NdeII GATC 1 cut(s) 28
PfeI GAWTC 1 cut(s) 23
PkrI GCNGC 2 cut(s) 103, 106
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 2 cut(s) 143, 156
SatI GCNGC 2 cut(s) 102, 105
Sau3AI GATC 1 cut(s) 28
SetI ASST 1 cut(s) 72
SfaNI GCATC 1 cut(s) 67
SgeI CNNG 5 cut(s) 54, 73, 79, 98, 107
Sse9I AATT 3 cut(s) 51, 140, 146
SspI AATATT 1 cut(s) 130
SspMI CTAG 1 cut(s) 42
TasI AATT 3 cut(s) 51, 140, 146
TatI WGTACW 1 cut(s) 63
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 2 cut(s) 143, 156
Tru9I TTAA 2 cut(s) 143, 156
TscAI CASTG 1 cut(s) 120
TseI GCWGC 2 cut(s) 101, 104
TspRI CASTG 1 cut(s) 120
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.