RchiOBHm_Chr1g0368551

P5CS plays a key role in proline biosynthesis, leading to osmoregulation in plants

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
58633676 .. 58634827
1152 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGCTTCACCTGTCTAAAATGATTATCAGAGGGAGAGGACAGGTTGTTGATGGTGATGTTACTTACAGCCACAAGGACCTCCTAGTTGAGACAGATGGAGGGAGACAAGAAAAGAGAAAGGGAGAGAGTATTGAGTCAATATCTTGCCTATTCAATGACATTTAG

Protein Analysis

54

Amino Acids

6.08

Weight (kDa)

6.03

Isoelectric Point (pI)

48.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 154
Alw26I GTCTC 2 cut(s) 83, 97
AspS9I GGNCC 1 cut(s) 76
AsuHPI GGTGA 1 cut(s) 65
AvaII GGWCC 1 cut(s) 76
BccI CCATC 2 cut(s) 44, 89
BcoDI GTCTC 2 cut(s) 83, 97
BfaI CTAG 1 cut(s) 83
Bme18I GGWCC 1 cut(s) 76
BmgT120I GGNCC 1 cut(s) 76
BsmAI GTCTC 2 cut(s) 83, 97
BstMAI GTCTC 2 cut(s) 83, 97
Cfr13I GGNCC 1 cut(s) 76
CviJI RGCY 1 cut(s) 69
CviKI_1 RGCY 1 cut(s) 69
Eco47I GGWCC 1 cut(s) 76
EcoO109I RGGNCCY 1 cut(s) 76
FspBI CTAG 1 cut(s) 83
HinfI GANTC 1 cut(s) 134
HphI GGTGA 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 29
LpnPI CCDG 2 cut(s) 23, 26
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 58
MlyI GAGTC 1 cut(s) 143
MnlI CCTC 4 cut(s) 23, 29, 89, 92
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
PpuMI RGGWCCY 1 cut(s) 76
Psp5II RGGWCCY 1 cut(s) 76
PspPI GGNCC 1 cut(s) 76
PspPPI RGGWCCY 1 cut(s) 76
Sau96I GGNCC 1 cut(s) 76
SchI GAGTC 1 cut(s) 143
SetI ASST 3 cut(s) 12, 45, 81
SgeI CNNG 6 cut(s) 22, 53, 85, 95, 119, 156
SinI GGWCC 1 cut(s) 76
SspMI CTAG 1 cut(s) 83
VpaK11BI GGWCC 1 cut(s) 76
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.