RchiOBHm_Chr1g0371821

protein serine/threonine kinase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
60806665 .. 60806895
231 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 180 bp
ATGCAGGGTTTGATGATCGTGACAACGGTGAGAAACAACAGCTTGCTAGACCAACCCTCTTTGAACGCTTTTGATATCATATCTCTTTCAAGTGGATTAGATTTGTCTGGTTTGTTCAAGATATGCCTGGTTCGACTTGTCAGCGTGTGTTCTTCGAAACTCCCAGCTACACTTTCATGA

Protein Analysis

59

Amino Acids

6.28

Weight (kDa)

7.81

Isoelectric Point (pI)

27.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAF PF03822 20 - 51 1.9e-11 NAF domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 64, 90, 118
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 2 cut(s) 42, 167
AluI AGCT 2 cut(s) 42, 167
AsuHPI GGTGA 1 cut(s) 40
AsuII TTCGAA 1 cut(s) 155
BciT130I CCWGG 1 cut(s) 128
BfaI CTAG 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 128
Bpu14I TTCGAA 1 cut(s) 155
BseBI CCWGG 1 cut(s) 128
BseYI CCCAGC 1 cut(s) 163
Bsp119I TTCGAA 1 cut(s) 155
Bsp143I GATC 1 cut(s) 15
BspHI TCATGA 1 cut(s) 176
BspT104I TTCGAA 1 cut(s) 155
BssMI GATC 1 cut(s) 15
Bst2UI CCWGG 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 28
BstBI TTCGAA 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 44
BstKTI GATC 1 cut(s) 18
BstMBI GATC 1 cut(s) 15
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 126
Cac8I GCNNGC 1 cut(s) 44
CciI TCATGA 1 cut(s) 176
CviAII CATG 1 cut(s) 177
CviJI RGCY 2 cut(s) 42, 167
CviKI_1 RGCY 2 cut(s) 42, 167
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
Eco32I GATATC 1 cut(s) 76
EcoRII CCWGG 1 cut(s) 126
EcoRV GATATC 1 cut(s) 76
FaeI CATG 1 cut(s) 180
FaiI YATR 3 cut(s) 80, 124, 178
FatI CATG 1 cut(s) 176
FspBI CTAG 1 cut(s) 47
FspEI CC 9 cut(s) 11, 65, 69, 70, 78, 93, 113, 140, 176
GsaI CCCAGC 1 cut(s) 167
Hin1II CATG 1 cut(s) 180
HphI GGTGA 1 cut(s) 40
Hpy188III TCNNGA 3 cut(s) 19, 118, 177
HpyCH4III ACNGT 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 180
Kzo9I GATC 1 cut(s) 15
LpnPI CCDG 3 cut(s) 93, 113, 140
MaeI CTAG 1 cut(s) 47
MaeIII GTNAC 1 cut(s) 19
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 1 cut(s) 144
MnlI CCTC 1 cut(s) 67
MslI CAYNNNNRTG 1 cut(s) 175
MspR9I CCNGG 1 cut(s) 128
MvaI CCWGG 1 cut(s) 128
NdeII GATC 1 cut(s) 15
NlaIII CATG 1 cut(s) 180
NmuCI GTSAC 1 cut(s) 19
NspV TTCGAA 1 cut(s) 155
PagI TCATGA 1 cut(s) 176
Psp6I CCWGG 1 cut(s) 126
PspFI CCCAGC 1 cut(s) 163
PspGI CCWGG 1 cut(s) 126
RseI CAYNNNNRTG 1 cut(s) 175
Sau3AI GATC 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 128
SetI ASST 2 cut(s) 44, 169
SfuI TTCGAA 1 cut(s) 155
SmiMI CAYNNNNRTG 1 cut(s) 175
SspMI CTAG 1 cut(s) 47
StyD4I CCNGG 1 cut(s) 126
TaaI ACNGT 1 cut(s) 28
TaqI TCGA 2 cut(s) 133, 155
TseFI GTSAC 1 cut(s) 19
Tsp45I GTSAC 1 cut(s) 19
TspDTI ATGAA 1 cut(s) 165
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.