RchiOBHm_Chr1g0373801

Ubiquinol-cytochrome-c reductase complex assembly factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
61837757 .. 61838800
1044 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGCATGCACTTACAATTGAGGTTTATGTGCAGGCAATGGCAAGATATGTTCGCCGGGAAGTTAGTTGTCTGTCCTTAACAGATAAAGAAGCTATGTTTTCCGGCAATTTCATGTTTACTCCACTAAAAATCGAGAAAGCAAAATTGGAGGGGTCCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

6.1

Weight (kDa)

8.98

Isoelectric Point (pI)

50.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjuI GAANNNNNNNTTGG 2 cut(s) 128, 160
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AspS9I GGNCC 1 cut(s) 153
AsuC2I CCSGG 1 cut(s) 56
AvaII GGWCC 1 cut(s) 153
BcnI CCSGG 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 56
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
BmiI GGNNCC 1 cut(s) 154
BmrFI CCNGG 1 cut(s) 56
BpuMI CCSGG 1 cut(s) 56
Bse3DI GCAATG 1 cut(s) 42
BseMI GCAATG 1 cut(s) 42
BsgI GTGCAG 1 cut(s) 50
BsiSI CCGG 2 cut(s) 55, 102
BspLI GGNNCC 1 cut(s) 154
BsrDI GCAATG 1 cut(s) 42
BstC8I GCNNGC 2 cut(s) 6, 33
BstNSI RCATGY 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 54
Cac8I GCNNGC 2 cut(s) 6, 33
Cfr13I GGNCC 1 cut(s) 153
CviAII CATG 2 cut(s) 5, 112
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
Eco47I GGWCC 1 cut(s) 153
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 8, 115
FaiI YATR 5 cut(s) 6, 27, 48, 95, 113
FatI CATG 2 cut(s) 4, 111
HapII CCGG 2 cut(s) 55, 102
Hin1II CATG 2 cut(s) 8, 115
HpaII CCGG 2 cut(s) 55, 102
Hpy166II GTNNAC 1 cut(s) 117
Hpy188III TCNNGA 2 cut(s) 133, 156
Hpy8I GTNNAC 1 cut(s) 117
HpyCH4V TGCA 3 cut(s) 4, 8, 31
Hsp92II CATG 2 cut(s) 8, 115
LpnPI CCDG 3 cut(s) 17, 68, 115
MfeI CAATTG 1 cut(s) 15
MluCI AATT 3 cut(s) 15, 106, 143
MnlI CCTC 2 cut(s) 13, 142
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 77
MspI CCGG 2 cut(s) 55, 102
MspR9I CCNGG 1 cut(s) 56
MunI CAATTG 1 cut(s) 15
NciI CCSGG 1 cut(s) 56
NlaIII CATG 2 cut(s) 8, 115
NlaIV GGNNCC 1 cut(s) 154
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PaeI GCATGC 1 cut(s) 8
PspN4I GGNNCC 1 cut(s) 154
PspPI GGNCC 1 cut(s) 153
SaqAI TTAA 1 cut(s) 77
Sau96I GGNCC 1 cut(s) 153
ScrFI CCNGG 1 cut(s) 56
SetI ASST 2 cut(s) 24, 94
SgeI CNNG 8 cut(s) 17, 44, 54, 67, 68, 114, 124, 145
SinI GGWCC 1 cut(s) 153
SphI GCATGC 1 cut(s) 8
Sse9I AATT 3 cut(s) 15, 106, 143
StyD4I CCNGG 1 cut(s) 54
TaqI TCGA 1 cut(s) 132
TasI AATT 3 cut(s) 15, 106, 143
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TspDTI ATGAA 1 cut(s) 100
VpaK11BI GGWCC 1 cut(s) 153
XceI RCATGY 1 cut(s) 8
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.