RchiOBHm_Chr1g0374741

Belongs to the AAA ATPase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
62451701 .. 62451949
249 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 249 bp
ATGTGTATGCTCAAGCTAAAGACATCAAGAAAGGGGACAGAATCGCCAGAAGGGGAAGTTTCTTCTTCCTCTAAGAAGAAGTACAAGCAACAACATAAGGTGACACTTTCGGGGTTGCTCAACATAATTGATGGTCTGTGGTCAAGCTGTGGTCATCAAAGACTTATTATATTCACCACCAACTACAAGCTCCAAGCTTGGAGTGAGCACGAACCCCCACAGTTCGGCTTAATTTGGTCTCCCCTATGA

Protein Analysis

82

Amino Acids

9.33

Weight (kDa)

9.47

Isoelectric Point (pI)

63.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 224
AluBI AGCT 4 cut(s) 16, 147, 190, 197
AluI AGCT 4 cut(s) 16, 147, 190, 197
Alw21I GWGCWC 1 cut(s) 210
Alw26I GTCTC 1 cut(s) 243
AsuHPI GGTGA 2 cut(s) 112, 166
Bbv12I GWGCWC 1 cut(s) 210
BccI CCATC 1 cut(s) 125
BcoDI GTCTC 1 cut(s) 243
BsaI GGTCTC 1 cut(s) 243
Bsc4I CCNNNNNNNGG 1 cut(s) 224
BseLI CCNNNNNNNGG 1 cut(s) 224
BsiHKAI GWGCWC 1 cut(s) 210
BslFI GGGAC 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 224
BsmAI GTCTC 1 cut(s) 243
BsmFI GGGAC 1 cut(s) 49
Bso31I GGTCTC 1 cut(s) 243
Bsp1286I GDGCHC 1 cut(s) 210
BspTNI GGTCTC 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 72
BstMAI GTCTC 1 cut(s) 243
Csp6I GTAC 1 cut(s) 82
CviJI RGCY 5 cut(s) 16, 147, 190, 197, 228
CviKI_1 RGCY 5 cut(s) 16, 147, 190, 197, 228
CviQI GTAC 1 cut(s) 82
DdeI CTNAG 1 cut(s) 72
Eco31I GGTCTC 1 cut(s) 243
FaiI YATR 5 cut(s) 8, 96, 125, 170, 247
FaqI GGGAC 1 cut(s) 49
HindIII AAGCTT 1 cut(s) 195
HinfI GANTC 1 cut(s) 41
HphI GGTGA 2 cut(s) 112, 166
Hpy188III TCNNGA 1 cut(s) 27
HpyAV CCTTC 1 cut(s) 44
HpyCH4III ACNGT 1 cut(s) 222
HpyF3I CTNAG 1 cut(s) 72
LmnI GCTCC 1 cut(s) 195
LpnPI CCDG 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 100
MboII GAAGA 3 cut(s) 54, 57, 88
MhlI GDGCHC 1 cut(s) 210
MluCI AATT 2 cut(s) 126, 231
MnlI CCTC 1 cut(s) 79
MseI TTAA 1 cut(s) 230
NmuCI GTSAC 1 cut(s) 100
PfeI GAWTC 1 cut(s) 41
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SaqAI TTAA 1 cut(s) 230
SduI GDGCHC 1 cut(s) 210
SetI ASST 5 cut(s) 18, 102, 149, 192, 199
SmlI CTYRAG 1 cut(s) 11
SmoI CTYRAG 1 cut(s) 11
Sse9I AATT 2 cut(s) 126, 231
TaaI ACNGT 1 cut(s) 222
TasI AATT 2 cut(s) 126, 231
TatI WGTACW 1 cut(s) 81
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TseFI GTSAC 1 cut(s) 100
Tsp45I GTSAC 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.