RchiOBHm_Chr1g0376181

PsaA and PsaB bind P700, the primary electron donor of photosystem I (PSI), as well as the electron acceptors A0, A1 and FX. PSI is a plastocyanin-ferredoxin oxidoreductase, converting photonic excitation into a charge separation, which transfers an electron from the donor P700 chlorophyll pair to the spectroscopically characterized acceptors A0, A1, FX, FA and FB in turn. Oxidized P700 is reduced on the lumenal side of the thylakoid membrane by plastocyanin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
63485610 .. 63485889
280 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGAATATTAATATATCTTCAACAAATGGTCCAGCGTTCAATGGGGGCCGAAGCATATGGTTACCTGGATCCGGAGACATCGTGGTTCATCATGCTATTGCTCTAGGTTTACATACAACTACATTGATCTCAGTAAAAGGTGCTTTAGGTGCACGTGGTTCTAAGTTAATGCCAAAACCCTTCTTTTCAACTTCAACGGTTGACTTGCCGAGGCACCGCTTAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
PsaA_PsaB

Protein Analysis

75

Amino Acids

7.91

Weight (kDa)

11.57

Isoelectric Point (pI)

33.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsaA_PsaB PF00223 23 - 59 8.8e-13 Photosystem I psaA/psaB protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 213
AccIII TCCGGA 1 cut(s) 71
AciI CCGC 1 cut(s) 217
AclWI GGATC 2 cut(s) 63, 76
AcvI CACGTG 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 71
AgsI TTSAA 4 cut(s) 21, 40, 189, 195
AjnI CCWGG 1 cut(s) 64
Alw21I GWGCWC 1 cut(s) 154
Alw26I GTCTC 1 cut(s) 69
Alw44I GTGCAC 1 cut(s) 150
AlwI GGATC 2 cut(s) 63, 76
Aor13HI TCCGGA 1 cut(s) 71
AoxI GGCC 1 cut(s) 46
ApaLI GTGCAC 1 cut(s) 150
AseI ATTAAT 1 cut(s) 9
AspS9I GGNCC 2 cut(s) 29, 46
AvaII GGWCC 1 cut(s) 29
BaeGI GKGCMC 1 cut(s) 154
BamHI GGATCC 1 cut(s) 68
BanI GGYRCC 1 cut(s) 213
BbrPI CACGTG 1 cut(s) 155
Bbv12I GWGCWC 1 cut(s) 154
BciT130I CCWGG 1 cut(s) 66
BcoDI GTCTC 1 cut(s) 69
BfaI CTAG 1 cut(s) 104
Bme1390I CCNGG 1 cut(s) 66
Bme18I GGWCC 1 cut(s) 29
BmgT120I GGNCC 2 cut(s) 29, 46
BmiI GGNNCC 3 cut(s) 47, 70, 215
BmrFI CCNGG 1 cut(s) 66
BsaAI YACGTR 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 209
BsaWI WCCGGW 1 cut(s) 71
BsaXI ACNNNNNCTCC 2 cut(s) 66, 96
Bsc4I CCNNNNNNNGG 1 cut(s) 71
BseAI TCCGGA 1 cut(s) 71
BseBI CCWGG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 209
BseLI CCNNNNNNNGG 1 cut(s) 71
BseMII CTCAG 1 cut(s) 144
BseSI GKGCMC 1 cut(s) 154
BshFI GGCC 1 cut(s) 48
BshNI GGYRCC 1 cut(s) 213
BsiHKAI GWGCWC 1 cut(s) 154
BsiSI CCGG 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 71
BsmAI GTCTC 1 cut(s) 69
BsnI GGCC 1 cut(s) 48
Bsp1286I GDGCHC 1 cut(s) 154
Bsp13I TCCGGA 1 cut(s) 71
Bsp143I GATC 2 cut(s) 68, 126
BspACI CCGC 1 cut(s) 217
BspANI GGCC 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 143
BspEI TCCGGA 1 cut(s) 71
BspLI GGNNCC 3 cut(s) 47, 70, 215
BspPI GGATC 2 cut(s) 63, 76
BspT107I GGYRCC 1 cut(s) 213
BssECI CCNNGG 1 cut(s) 209
BssMI GATC 2 cut(s) 68, 126
Bst2UI CCWGG 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 199
BstBAI YACGTR 1 cut(s) 155
BstDEI CTNAG 2 cut(s) 130, 162
BstEII GGTNACC 1 cut(s) 60
BstKTI GATC 2 cut(s) 71, 129
BstMAI GTCTC 1 cut(s) 69
BstMBI GATC 2 cut(s) 68, 126
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstNI CCWGG 1 cut(s) 66
BstPI GGTNACC 1 cut(s) 60
BstSCI CCNGG 1 cut(s) 64
BstSLI GKGCMC 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
BsuRI GGCC 1 cut(s) 48
Cfr13I GGNCC 2 cut(s) 29, 46
CviAII CATG 1 cut(s) 92
CviJI RGCY 1 cut(s) 48
CviKI_1 RGCY 1 cut(s) 48
DdeI CTNAG 2 cut(s) 130, 162
DpnI GATC 2 cut(s) 70, 128
DpnII GATC 2 cut(s) 68, 126
Eco47I GGWCC 1 cut(s) 29
Eco72I CACGTG 1 cut(s) 155
Eco91I GGTNACC 1 cut(s) 60
EcoO65I GGTNACC 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 64
FaeI CATG 1 cut(s) 95
FaiI YATR 5 cut(s) 14, 56, 58, 93, 114
FatI CATG 1 cut(s) 91
FauNDI CATATG 1 cut(s) 56
FspBI CTAG 1 cut(s) 104
HaeIII GGCC 1 cut(s) 48
HapII CCGG 1 cut(s) 72
Hin1II CATG 1 cut(s) 95
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HpaII CCGG 1 cut(s) 72
Hpy166II GTNNAC 3 cut(s) 110, 152, 202
Hpy188III TCNNGA 1 cut(s) 72
Hpy8I GTNNAC 3 cut(s) 110, 152, 202
HpyAV CCTTC 1 cut(s) 190
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4IV ACGT 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
HpyF3I CTNAG 2 cut(s) 130, 162
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 1 cut(s) 95
Kpn2I TCCGGA 1 cut(s) 71
Kzo9I GATC 2 cut(s) 68, 126
LpnPI CCDG 4 cut(s) 45, 51, 78, 85
MaeI CTAG 1 cut(s) 104
MaeII ACGT 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 60
MalI GATC 2 cut(s) 70, 128
MboI GATC 2 cut(s) 68, 126
MboII GAAGA 1 cut(s) 9
MflI RGATCY 1 cut(s) 68
MhlI GDGCHC 1 cut(s) 154
MluCI AATT 1 cut(s) 223
MnlI CCTC 1 cut(s) 204
MroI TCCGGA 1 cut(s) 71
MseI TTAA 3 cut(s) 9, 167, 221
MspI CCGG 1 cut(s) 72
MspR9I CCNGG 1 cut(s) 66
MvaI CCWGG 1 cut(s) 66
MwoI GCNNNNNNNGC 1 cut(s) 149
NdeI CATATG 1 cut(s) 56
NdeII GATC 2 cut(s) 68, 126
NlaIII CATG 1 cut(s) 95
NlaIV GGNNCC 3 cut(s) 47, 70, 215
PmaCI CACGTG 1 cut(s) 155
PmlI CACGTG 1 cut(s) 155
Ppu21I YACGTR 1 cut(s) 155
PshBI ATTAAT 1 cut(s) 9
Psp6I CCWGG 1 cut(s) 64
PspCI CACGTG 1 cut(s) 155
PspEI GGTNACC 1 cut(s) 60
PspGI CCWGG 1 cut(s) 64
PspN4I GGNNCC 3 cut(s) 47, 70, 215
PspPI GGNCC 2 cut(s) 29, 46
PsuI RGATCY 1 cut(s) 68
SaqAI TTAA 3 cut(s) 9, 167, 221
Sau3AI GATC 2 cut(s) 68, 126
Sau96I GGNCC 2 cut(s) 29, 46
ScrFI CCNGG 1 cut(s) 66
SduI GDGCHC 1 cut(s) 154
SetI ASST 5 cut(s) 67, 109, 142, 151, 157
SinI GGWCC 1 cut(s) 29
Sse9I AATT 1 cut(s) 223
SsiI CCGC 1 cut(s) 217
SspI AATATT 1 cut(s) 7
SspMI CTAG 1 cut(s) 104
StyD4I CCNGG 1 cut(s) 64
TaaI ACNGT 1 cut(s) 199
TaiI ACGT 1 cut(s) 157
TasI AATT 1 cut(s) 223
Tru1I TTAA 3 cut(s) 9, 167, 221
Tru9I TTAA 3 cut(s) 9, 167, 221
TspDTI ATGAA 2 cut(s) 17, 77
VneI GTGCAC 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 29
VspI ATTAAT 1 cut(s) 9
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.