RchiOBHm_Chr1g0376261

Prolyl 4-hydroxylase alpha subunit homologues.

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
63530263 .. 63530824
562 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGATCAGGTCCAGAATTTCTTCACATCTGCAGAATCAAAGGCTTTTTGTTAAGGTTGCAGAGTTTATTGGGTTTGTTCACCAAGGAAGTCTTGGCCCAACGAAAGGTGAAGCTTACAGAGATAATGATAGAATCTCTGTGAACGATCCTGTTCTTGCTGATTTTATATGGAACTCTGGGCTCAGCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.1

Weight (kDa)

8.29

Isoelectric Point (pI)

21.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AcsI RAATTY 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 104
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
AlwI GGATC 1 cut(s) 140
AlwNI CAGNNNCTG 1 cut(s) 189
AoxI GGCC 1 cut(s) 94
ApoI RAATTY 1 cut(s) 15
Asp700I GAANNNNTTC 1 cut(s) 19
AspS9I GGNCC 2 cut(s) 9, 95
AsuHPI GGTGA 2 cut(s) 71, 119
AvaII GGWCC 1 cut(s) 9
BanII GRGCYC 1 cut(s) 183
BclI TGATCA 1 cut(s) 3
BfmI CTRYAG 1 cut(s) 29
BlpI GCTNAGC 1 cut(s) 182
Bme18I GGWCC 1 cut(s) 9
BmgT120I GGNCC 2 cut(s) 9, 95
Bpu1102I GCTNAGC 1 cut(s) 182
BsaJI CCNNGG 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 104
BseDI CCNNGG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 104
BshFI GGCC 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 104
BsnI GGCC 1 cut(s) 96
Bsp1286I GDGCHC 1 cut(s) 183
Bsp143I GATC 2 cut(s) 3, 145
Bsp1720I GCTNAGC 1 cut(s) 182
BspANI GGCC 1 cut(s) 96
BspMAI CTGCAG 1 cut(s) 33
BspPI GGATC 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 82
BssMI GATC 2 cut(s) 3, 145
BssT1I CCWWGG 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 182
BstKTI GATC 2 cut(s) 6, 148
BstMBI GATC 2 cut(s) 3, 145
BstSFI CTRYAG 1 cut(s) 29
BsuRI GGCC 1 cut(s) 96
CaiI CAGNNNCTG 1 cut(s) 189
Cfr13I GGNCC 2 cut(s) 9, 95
CviJI RGCY 4 cut(s) 43, 96, 113, 181
CviKI_1 RGCY 4 cut(s) 43, 96, 113, 181
DdeI CTNAG 1 cut(s) 182
DpnI GATC 2 cut(s) 5, 147
DpnII GATC 2 cut(s) 3, 145
Eco130I CCWWGG 1 cut(s) 82
Eco24I GRGCYC 1 cut(s) 183
Eco47I GGWCC 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 82
EcoT38I GRGCYC 1 cut(s) 183
ErhI CCWWGG 1 cut(s) 82
FaiI YATR 2 cut(s) 167, 169
FalI AAGNNNNNCTT 2 cut(s) 75, 107
FbaI TGATCA 1 cut(s) 3
FriOI GRGCYC 1 cut(s) 183
HaeIII GGCC 1 cut(s) 96
HindIII AAGCTT 1 cut(s) 111
HinfI GANTC 2 cut(s) 34, 132
HphI GGTGA 2 cut(s) 71, 119
Hpy166II GTNNAC 2 cut(s) 79, 142
Hpy188III TCNNGA 1 cut(s) 12
Hpy8I GTNNAC 2 cut(s) 79, 142
HpyCH4V TGCA 2 cut(s) 31, 59
HpyF3I CTNAG 1 cut(s) 182
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 145
LpnPI CCDG 3 cut(s) 25, 162, 162
MalI GATC 2 cut(s) 5, 147
MboI GATC 2 cut(s) 3, 145
MboII GAAGA 1 cut(s) 12
MhlI GDGCHC 1 cut(s) 183
MluCI AATT 1 cut(s) 15
MroXI GAANNNNTTC 1 cut(s) 19
MseI TTAA 1 cut(s) 51
NdeII GATC 2 cut(s) 3, 145
PdmI GAANNNNTTC 1 cut(s) 19
PfeI GAWTC 2 cut(s) 34, 132
PspPI GGNCC 2 cut(s) 9, 95
PstI CTGCAG 1 cut(s) 33
PstNI CAGNNNCTG 1 cut(s) 189
SaqAI TTAA 1 cut(s) 51
Sau3AI GATC 2 cut(s) 3, 145
Sau96I GGNCC 2 cut(s) 9, 95
SduI GDGCHC 1 cut(s) 183
SetI ASST 4 cut(s) 11, 57, 109, 115
SfcI CTRYAG 1 cut(s) 29
SgeI CNNG 6 cut(s) 19, 24, 95, 104, 161, 167
SinI GGWCC 1 cut(s) 9
Sse9I AATT 1 cut(s) 15
StyI CCWWGG 1 cut(s) 82
TasI AATT 1 cut(s) 15
TfiI GAWTC 2 cut(s) 34, 132
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
VpaK11BI GGWCC 1 cut(s) 9
XapI RAATTY 1 cut(s) 15
XcmI CCANNNNNNNNNTGG 1 cut(s) 89
XmnI GAANNNNTTC 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.