RchiOBHm_Chr1g0378331

Belongs to the glycosyl hydrolase 28 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
64900182 .. 64900370
189 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGTCCGGTGGAATCAGAGATGTTAGAGTTGAGGATGTCACATCCATTAACACTGAATCTAGTATTAGGATCAAAACAGCTAAAGGGAGAGGGGCTGATGTCAATGACATCTTTGTACAACGATTAACATTGAACACTGTTAGTATATATAGGAACTTGTATGTTGGCATTCCCTTTATACAAAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.91

Weight (kDa)

9.51

Isoelectric Point (pI)

18.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 77
AfaI GTAC 1 cut(s) 117
AgsI TTSAA 1 cut(s) 133
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
AlwI GGATC 1 cut(s) 77
BfaI CTAG 2 cut(s) 60, 187
BsaWI WCCGGW 1 cut(s) 5
BseGI GGATG 2 cut(s) 40, 41
BsiSI CCGG 1 cut(s) 6
BsmI GAATGC 1 cut(s) 168
Bsp1407I TGTACA 1 cut(s) 115
Bsp143I GATC 1 cut(s) 69
BspPI GGATC 1 cut(s) 77
BsrGI TGTACA 1 cut(s) 115
BssMI GATC 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 139
BstAUI TGTACA 1 cut(s) 115
BstF5I GGATG 2 cut(s) 40, 41
BstKTI GATC 1 cut(s) 72
BstMBI GATC 1 cut(s) 69
BtsCI GGATG 2 cut(s) 40, 41
BtsIMutI CAGTG 2 cut(s) 51, 135
Csp6I GTAC 1 cut(s) 116
CviJI RGCY 2 cut(s) 80, 95
CviKI_1 RGCY 2 cut(s) 80, 95
CviQI GTAC 1 cut(s) 116
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
FaiI YATR 5 cut(s) 146, 148, 150, 162, 179
FokI GGATG 2 cut(s) 28, 47
FspBI CTAG 2 cut(s) 60, 187
HapII CCGG 1 cut(s) 6
HinfI GANTC 2 cut(s) 12, 56
HpaII CCGG 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 139
Kzo9I GATC 1 cut(s) 69
LpnPI CCDG 1 cut(s) 19
MaeI CTAG 2 cut(s) 60, 187
MaeIII GTNAC 1 cut(s) 37
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MnlI CCTC 2 cut(s) 25, 83
MseI TTAA 2 cut(s) 48, 125
MspI CCGG 1 cut(s) 6
Mva1269I GAATGC 1 cut(s) 168
NdeII GATC 1 cut(s) 69
NmuCI GTSAC 1 cut(s) 37
PctI GAATGC 1 cut(s) 168
PfeI GAWTC 2 cut(s) 12, 56
RsaI GTAC 1 cut(s) 117
RsaNI GTAC 1 cut(s) 116
SaqAI TTAA 2 cut(s) 48, 125
Sau3AI GATC 1 cut(s) 69
SetI ASST 1 cut(s) 82
SgeI CNNG 3 cut(s) 18, 72, 169
SspMI CTAG 2 cut(s) 60, 187
TaaI ACNGT 1 cut(s) 139
TatI WGTACW 1 cut(s) 115
TfiI GAWTC 2 cut(s) 12, 56
Tru1I TTAA 2 cut(s) 48, 125
Tru9I TTAA 2 cut(s) 48, 125
TscAI CASTG 2 cut(s) 58, 142
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspRI CASTG 2 cut(s) 58, 142
XspI CTAG 2 cut(s) 60, 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.