RchiOBHm_Chr1g0379761

Protein of unknown function (DUF3143)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
65714031 .. 65715704
1674 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 153 bp
ATGCCCAGCTCTCTCTCGACGTTACCGATCTCTATGTCAGGGATGTGGTATCTGAAGACCGGACCTGGAAATCTTGAAAAGGATATGGAGAGGAGGTTTAGCTATGCACTGAGCAGAGAGGACATCGAAAATGCAGTGCTTGGAGGTCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.53

Weight (kDa)

5.05

Isoelectric Point (pI)

68.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3143 PF11341 17 - 49 6.2e-09 Protein of unknown function (DUF3143)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 74
AgsI TTSAA 1 cut(s) 77
AjnI CCWGG 1 cut(s) 64
AluBI AGCT 2 cut(s) 9, 102
AluI AGCT 2 cut(s) 9, 102
AspS9I GGNCC 2 cut(s) 62, 146
AvaII GGWCC 2 cut(s) 62, 146
BbsI GAAGAC 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 66
Bme1390I CCNGG 1 cut(s) 66
Bme18I GGWCC 2 cut(s) 62, 146
BmgT120I GGNCC 2 cut(s) 62, 146
BmiI GGNNCC 1 cut(s) 148
BmrFI CCNGG 1 cut(s) 66
BpiI GAAGAC 1 cut(s) 62
BsaWI WCCGGW 1 cut(s) 59
BsaXI ACNNNNNCTCC 2 cut(s) 80, 110
BseBI CCWGG 1 cut(s) 66
BseGI GGATG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 101
BseRI GAGGAG 1 cut(s) 106
BseYI CCCAGC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 60
BslFI GGGAC 1 cut(s) 132
BsmFI GGGAC 1 cut(s) 132
Bsp143I GATC 1 cut(s) 27
BspCNI CTCAG 1 cut(s) 102
BspLI GGNNCC 1 cut(s) 148
BssMI GATC 1 cut(s) 27
Bst2UI CCWGG 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 110
BstF5I GGATG 1 cut(s) 48
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstNI CCWGG 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 62
BtsCI GGATG 1 cut(s) 48
BtsI GCAGTG 1 cut(s) 141
BtsIMutI CAGTG 2 cut(s) 107, 141
Cfr13I GGNCC 2 cut(s) 62, 146
CviJI RGCY 2 cut(s) 9, 102
CviKI_1 RGCY 2 cut(s) 9, 102
DdeI CTNAG 1 cut(s) 110
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
Eco47I GGWCC 2 cut(s) 62, 146
Eco57I CTGAAG 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 64
FaiI YATR 3 cut(s) 35, 86, 105
FaqI GGGAC 1 cut(s) 132
FokI GGATG 1 cut(s) 55
GsaI CCCAGC 1 cut(s) 9
HapII CCGG 1 cut(s) 60
HpaII CCGG 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 2 cut(s) 16, 74
Hpy99I CGWCG 1 cut(s) 22
HpyCH4IV ACGT 1 cut(s) 20
HpyCH4V TGCA 2 cut(s) 107, 134
HpyF3I CTNAG 1 cut(s) 110
HpySE526I ACGT 1 cut(s) 20
Kzo9I GATC 1 cut(s) 27
LpnPI CCDG 5 cut(s) 19, 24, 51, 73, 78
MaeII ACGT 1 cut(s) 20
MaeIII GTNAC 1 cut(s) 21
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 1 cut(s) 67
MnlI CCTC 4 cut(s) 84, 87, 112, 137
MspI CCGG 1 cut(s) 60
MspR9I CCNGG 1 cut(s) 66
MvaI CCWGG 1 cut(s) 66
NdeII GATC 1 cut(s) 27
NlaIV GGNNCC 1 cut(s) 148
PcsI WCGNNNNNNNCGW 1 cut(s) 23
PpuMI RGGWCCY 1 cut(s) 146
Psp5II RGGWCCY 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 64
PspFI CCCAGC 1 cut(s) 5
PspGI CCWGG 1 cut(s) 64
PspN4I GGNNCC 1 cut(s) 148
PspPI GGNCC 2 cut(s) 62, 146
PspPPI RGGWCCY 1 cut(s) 146
Sau3AI GATC 1 cut(s) 27
Sau96I GGNCC 2 cut(s) 62, 146
ScrFI CCNGG 1 cut(s) 66
SetI ASST 6 cut(s) 11, 23, 67, 98, 104, 148
SgeI CNNG 7 cut(s) 18, 28, 51, 72, 77, 78, 86
SinI GGWCC 2 cut(s) 62, 146
StyD4I CCNGG 1 cut(s) 64
TaiI ACGT 1 cut(s) 23
TaqI TCGA 2 cut(s) 17, 126
TscAI CASTG 2 cut(s) 114, 141
TspRI CASTG 2 cut(s) 114, 141
VpaK11BI GGWCC 2 cut(s) 62, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.