RchiOBHm_Chr1g0380831

Belongs to the eukaryotic ribosomal protein eL13 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
66304858 .. 66309496
4639 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGAAGCACAATAATGTTATCCTTGGGGAGCACTTCAGGAAGCACCGGCAGAACAATGTCAAGACCTGGTTAAACGAACCAGCACCAGGCTTTCTTATATTGCTTCTTCCTAAAATCACAGCTCGCGGCAAAGCTGTGAAAATCTTTCCTAGGCCTACTGCTGGACCTCTCCTACCAGTTGTTCGTGACAGACATTGA

Protein Analysis

65

Amino Acids

7.45

Weight (kDa)

11.73

Isoelectric Point (pI)

36.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L13e PF01294 7 - 62 1.5e-06 Ribosomal protein L13e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 126
AciI CCGC 1 cut(s) 126
AcuI CTGAAG 1 cut(s) 19
AfiI CCNNNNNNNGG 2 cut(s) 86, 161
AjnI CCWGG 2 cut(s) 65, 85
AluBI AGCT 2 cut(s) 122, 134
AluI AGCT 2 cut(s) 122, 134
Alw21I GWGCWC 1 cut(s) 33
AoxI GGCC 1 cut(s) 152
AspA2I CCTAGG 1 cut(s) 149
AspS9I GGNCC 1 cut(s) 164
AvaII GGWCC 1 cut(s) 164
AvrII CCTAGG 1 cut(s) 149
Bbv12I GWGCWC 1 cut(s) 33
BciT130I CCWGG 2 cut(s) 67, 87
BfaI CTAG 1 cut(s) 150
BisI GCNGC 1 cut(s) 127
BlnI CCTAGG 1 cut(s) 149
BlsI GCNGC 1 cut(s) 128
Bme1390I CCNGG 2 cut(s) 67, 87
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 1 cut(s) 164
BmrFI CCNGG 2 cut(s) 67, 87
BsaJI CCNNGG 2 cut(s) 22, 149
Bsc4I CCNNNNNNNGG 2 cut(s) 86, 161
Bse118I RCCGGY 1 cut(s) 45
Bse1I ACTGG 1 cut(s) 176
BseBI CCWGG 2 cut(s) 67, 87
BseDI CCNNGG 2 cut(s) 22, 149
BseLI CCNNNNNNNGG 2 cut(s) 86, 161
BseNI ACTGG 1 cut(s) 176
Bsh1236I CGCG 1 cut(s) 126
BshFI GGCC 1 cut(s) 154
BsiHKAI GWGCWC 1 cut(s) 33
BsiSI CCGG 1 cut(s) 46
BslI CCNNNNNNNGG 2 cut(s) 86, 161
BsnI GGCC 1 cut(s) 154
Bsp1286I GDGCHC 1 cut(s) 33
BspACI CCGC 1 cut(s) 126
BspANI GGCC 1 cut(s) 154
BspFNI CGCG 1 cut(s) 126
BsrFI RCCGGY 1 cut(s) 45
BsrI ACTGG 1 cut(s) 176
BssAI RCCGGY 1 cut(s) 45
BssECI CCNNGG 2 cut(s) 22, 149
BssT1I CCWWGG 2 cut(s) 22, 149
Bst2UI CCWGG 2 cut(s) 67, 87
BstC8I GCNNGC 1 cut(s) 124
BstFNI CGCG 1 cut(s) 126
BstNI CCWGG 2 cut(s) 67, 87
BstSCI CCNGG 2 cut(s) 65, 85
BstUI CGCG 1 cut(s) 126
BsuRI GGCC 1 cut(s) 154
Cac8I GCNNGC 1 cut(s) 124
Cfr10I RCCGGY 1 cut(s) 45
Cfr13I GGNCC 1 cut(s) 164
CsiI ACCWGGT 1 cut(s) 65
CviJI RGCY 4 cut(s) 90, 122, 134, 154
CviKI_1 RGCY 4 cut(s) 90, 122, 134, 154
Eco130I CCWWGG 2 cut(s) 22, 149
Eco147I AGGCCT 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 164
Eco57I CTGAAG 1 cut(s) 19
EcoRII CCWGG 2 cut(s) 65, 85
EcoT14I CCWWGG 2 cut(s) 22, 149
ErhI CCWWGG 2 cut(s) 22, 149
FaiI YATR 1 cut(s) 98
Fnu4HI GCNGC 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 127
FspBI CTAG 1 cut(s) 150
GluI GCNGC 1 cut(s) 127
HaeIII GGCC 1 cut(s) 154
HapII CCGG 1 cut(s) 46
HpaII CCGG 1 cut(s) 46
Hpy188III TCNNGA 3 cut(s) 37, 61, 185
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 9 cut(s) 22, 52, 59, 72, 79, 93, 99, 147, 189
MabI ACCWGGT 1 cut(s) 65
MaeI CTAG 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 185
MboII GAAGA 1 cut(s) 98
MhlI GDGCHC 1 cut(s) 33
MnlI CCTC 1 cut(s) 177
MseI TTAA 1 cut(s) 71
MslI CAYNNNNRTG 1 cut(s) 12
MspI CCGG 1 cut(s) 46
MspR9I CCNGG 2 cut(s) 67, 87
MvaI CCWGG 2 cut(s) 67, 87
MvnI CGCG 1 cut(s) 126
NmuCI GTSAC 1 cut(s) 185
PceI AGGCCT 1 cut(s) 154
PkrI GCNGC 1 cut(s) 128
Psp6I CCWGG 2 cut(s) 65, 85
PspGI CCWGG 2 cut(s) 65, 85
PspPI GGNCC 1 cut(s) 164
RseI CAYNNNNRTG 1 cut(s) 12
SaqAI TTAA 1 cut(s) 71
SatI GCNGC 1 cut(s) 127
Sau96I GGNCC 1 cut(s) 164
ScrFI CCNGG 2 cut(s) 67, 87
SduI GDGCHC 1 cut(s) 33
SetI ASST 4 cut(s) 68, 124, 136, 169
SexAI ACCWGGT 1 cut(s) 65
SinI GGWCC 1 cut(s) 164
SmiMI CAYNNNNRTG 1 cut(s) 12
SseBI AGGCCT 1 cut(s) 154
SsiI CCGC 1 cut(s) 126
SspMI CTAG 1 cut(s) 150
StuI AGGCCT 1 cut(s) 154
StyD4I CCNGG 2 cut(s) 65, 85
StyI CCWWGG 2 cut(s) 22, 149
TauI GCSGC 1 cut(s) 129
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TseFI GTSAC 1 cut(s) 185
Tsp45I GTSAC 1 cut(s) 185
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 164
XmaJI CCTAGG 1 cut(s) 149
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.