RchiOBHm_Chr1g0382591

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
67381006 .. 67384554
3549 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGCATCCATTTGTTTTGCATCAACCTGGGGTTCCCCATTCCATGCCACCACAGTTTCCCCAATCACATGCTCCGTCCGAGAGTTTGCAGATAGCTACACAAACTGAACCTCCATCTTCCCAAAATGATCAAAACCTGATAAATCAGATGCAAAGTATCACTATGAAACTTCTGTTAATGGGCAACCATTTCATCAAGACTATTTGGATGTTCAAATTCGCGAAGGGGCAGAGCCTGAACCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.18

Weight (kDa)

8.28

Isoelectric Point (pI)

74.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 221
AcsI RAATTY 1 cut(s) 215
AgsI TTSAA 1 cut(s) 214
AjnI CCWGG 1 cut(s) 25
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AlwNI CAGNNNCTG 1 cut(s) 235
ApoI RAATTY 1 cut(s) 215
BccI CCATC 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 27
BclI TGATCA 1 cut(s) 127
Bme1390I CCNGG 1 cut(s) 27
BmiI GGNNCC 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 27
BmsI GCATC 3 cut(s) 13, 28, 138
BsaJI CCNNGG 1 cut(s) 26
BsaXI ACNNNNNCTCC 2 cut(s) 94, 124
BseBI CCWGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 26
BseGI GGATG 2 cut(s) 4, 213
Bsh1236I CGCG 1 cut(s) 221
Bsp143I GATC 1 cut(s) 127
Bsp68I TCGCGA 1 cut(s) 221
BspFNI CGCG 1 cut(s) 221
BspLI GGNNCC 1 cut(s) 33
BssECI CCNNGG 1 cut(s) 26
BssMI GATC 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 27
Bst4CI ACNGT 1 cut(s) 54
BstF5I GGATG 2 cut(s) 4, 213
BstFNI CGCG 1 cut(s) 221
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 27
BstNSI RCATGY 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 25
BstUI CGCG 1 cut(s) 221
BtsCI GGATG 2 cut(s) 4, 213
BtuMI TCGCGA 1 cut(s) 221
CaiI CAGNNNCTG 1 cut(s) 235
CviAII CATG 2 cut(s) 43, 68
CviJI RGCY 2 cut(s) 95, 234
CviKI_1 RGCY 2 cut(s) 95, 234
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 25
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 46, 71
FaiI YATR 3 cut(s) 44, 69, 164
FatI CATG 2 cut(s) 42, 67
FbaI TGATCA 1 cut(s) 127
FokI GGATG 1 cut(s) 220
Hin1II CATG 2 cut(s) 46, 71
Hpy188I TCNGA 2 cut(s) 79, 147
Hpy188III TCNNGA 2 cut(s) 196, 220
HpyAV CCTTC 1 cut(s) 217
HpyCH4III ACNGT 1 cut(s) 54
HpyCH4V TGCA 4 cut(s) 4, 19, 88, 151
Hsp92II CATG 2 cut(s) 46, 71
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 1 cut(s) 127
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 3 cut(s) 12, 39, 149
LweI GCATC 3 cut(s) 13, 28, 138
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 1 cut(s) 108
MluCI AATT 1 cut(s) 215
MnlI CCTC 1 cut(s) 120
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 176
MspR9I CCNGG 1 cut(s) 27
MvaI CCWGG 1 cut(s) 27
MvnI CGCG 1 cut(s) 221
NdeII GATC 1 cut(s) 127
NlaIII CATG 2 cut(s) 46, 71
NlaIV GGNNCC 1 cut(s) 33
NruI TCGCGA 1 cut(s) 221
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 71
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 33
PstNI CAGNNNCTG 1 cut(s) 235
RruI TCGCGA 1 cut(s) 221
SaqAI TTAA 1 cut(s) 176
Sau3AI GATC 1 cut(s) 127
ScrFI CCNGG 1 cut(s) 27
SetI ASST 5 cut(s) 28, 97, 112, 138, 243
SfaNI GCATC 3 cut(s) 13, 28, 138
SgeI CNNG 8 cut(s) 38, 39, 55, 80, 91, 148, 208, 232
Sse9I AATT 1 cut(s) 215
StyD4I CCNGG 1 cut(s) 25
TaaI ACNGT 1 cut(s) 54
TasI AATT 1 cut(s) 215
Tru1I TTAA 1 cut(s) 176
Tru9I TTAA 1 cut(s) 176
TspDTI ATGAA 2 cut(s) 179, 181
TspGWI ACGGA 1 cut(s) 63
XapI RAATTY 1 cut(s) 215
XceI RCATGY 1 cut(s) 71
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.