RchiOBHm_Chr1g0319191

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
6863214 .. 6866985
3772 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54944

Sequence Viewer

Length: 285 bp
ATGGCAACTTTGCTTCACAGATTCATAATGTTATATGCGCTCGACATGGATTTGGATTGCTCAGGTGGCCGGGGAAAGCTTCCTGTTGATGAAGTAAGCTTTAAAGTGCTCGGCATTTGTATTATAGATCCGAGGAGGAGAGGAGAGCTTGATTGGGATAGACGCTTTAATATTATTCAGGGTATTGCTAGAGGGCTTCTTTATCTCCATCATGATTCCTATGTGAAGGTAATACATAGAGATTTGAAAATCAGCAACATTCTCCTGGATGAAAAAATGAAATAA

Protein Analysis

94

Amino Acids

10.95

Weight (kDa)

8.66

Isoelectric Point (pI)

39.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 47 - 92 7.6e-06 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 49 - 92 1.2e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 122
AcoI YGGCCR 1 cut(s) 67
AgsI TTSAA 1 cut(s) 247
AjnI CCWGG 1 cut(s) 264
AluBI AGCT 3 cut(s) 79, 99, 148
AluI AGCT 3 cut(s) 79, 99, 148
Alw21I GWGCWC 1 cut(s) 111
AlwI GGATC 1 cut(s) 122
AoxI GGCC 1 cut(s) 67
AspLEI GCGC 1 cut(s) 40
AsuC2I CCSGG 1 cut(s) 71
Bbv12I GWGCWC 1 cut(s) 111
BccI CCATC 1 cut(s) 216
BciT130I CCWGG 1 cut(s) 266
BcnI CCSGG 1 cut(s) 71
BfaI CTAG 1 cut(s) 189
Bme1390I CCNGG 2 cut(s) 71, 266
BmrFI CCNGG 2 cut(s) 71, 266
Bpu10I CCTNAGC 1 cut(s) 61
BpuMI CCSGG 1 cut(s) 71
BsaJI CCNNGG 2 cut(s) 70, 131
BseBI CCWGG 1 cut(s) 266
BseDI CCNNGG 2 cut(s) 70, 131
BseGI GGATG 1 cut(s) 274
BseMII CTCAG 1 cut(s) 75
BseRI GAGGAG 3 cut(s) 148, 151, 156
BshFI GGCC 1 cut(s) 69
BsiHKAI GWGCWC 1 cut(s) 111
BsiSI CCGG 1 cut(s) 70
BsnI GGCC 1 cut(s) 69
Bsp1286I GDGCHC 1 cut(s) 111
Bsp143I GATC 1 cut(s) 127
BspANI GGCC 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 74
BspHI TCATGA 1 cut(s) 211
BspPI GGATC 1 cut(s) 122
BssECI CCNNGG 2 cut(s) 70, 131
BssMI GATC 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 266
BstDEI CTNAG 1 cut(s) 61
BstF5I GGATG 1 cut(s) 274
BstHHI GCGC 1 cut(s) 40
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstMWI GCNNNNNNNGC 1 cut(s) 66
BstNI CCWGG 1 cut(s) 266
BstSCI CCNGG 2 cut(s) 69, 264
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
BsuRI GGCC 1 cut(s) 69
BtsCI GGATG 1 cut(s) 274
CciI TCATGA 1 cut(s) 211
CfoI GCGC 1 cut(s) 40
CseI GACGC 1 cut(s) 171
CviAII CATG 2 cut(s) 46, 212
CviJI RGCY 5 cut(s) 69, 79, 99, 148, 196
CviKI_1 RGCY 5 cut(s) 69, 79, 99, 148, 196
DdeI CTNAG 1 cut(s) 61
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
DraI TTTAAA 1 cut(s) 103
EaeI YGGCCR 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 264
FaeI CATG 2 cut(s) 49, 215
FaiI YATR 8 cut(s) 26, 34, 36, 47, 125, 213, 222, 237
FatI CATG 2 cut(s) 45, 211
FokI GGATG 1 cut(s) 281
FspBI CTAG 1 cut(s) 189
GlaI GCGC 1 cut(s) 39
HaeIII GGCC 1 cut(s) 69
HapII CCGG 1 cut(s) 70
HgaI GACGC 1 cut(s) 171
HhaI GCGC 1 cut(s) 40
Hin1II CATG 2 cut(s) 49, 215
Hin6I GCGC 1 cut(s) 38
HinP1I GCGC 1 cut(s) 38
HindIII AAGCTT 2 cut(s) 77, 97
HinfI GANTC 2 cut(s) 21, 215
HpaII CCGG 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 132
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 220
HpyF10VI GCNNNNNNNGC 1 cut(s) 66
HpyF3I CTNAG 1 cut(s) 61
Hsp92II CATG 2 cut(s) 49, 215
HspAI GCGC 1 cut(s) 38
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 6 cut(s) 48, 83, 96, 164, 251, 278
MaeI CTAG 1 cut(s) 189
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MflI RGATCY 1 cut(s) 127
MhlI GDGCHC 1 cut(s) 111
MnlI CCTC 4 cut(s) 126, 129, 134, 185
MseI TTAA 2 cut(s) 102, 168
MspI CCGG 1 cut(s) 70
MspR9I CCNGG 2 cut(s) 71, 266
MvaI CCWGG 1 cut(s) 266
MwoI GCNNNNNNNGC 1 cut(s) 66
NciI CCSGG 1 cut(s) 71
NdeII GATC 1 cut(s) 127
NlaIII CATG 2 cut(s) 49, 215
NmeAIII GCCGAG 1 cut(s) 90
PagI TCATGA 1 cut(s) 211
PfeI GAWTC 2 cut(s) 21, 215
PfoI TCCNGGA 1 cut(s) 264
Psp6I CCWGG 1 cut(s) 264
PspGI CCWGG 1 cut(s) 264
PsuI RGATCY 1 cut(s) 127
SaqAI TTAA 2 cut(s) 102, 168
Sau3AI GATC 1 cut(s) 127
ScrFI CCNGG 2 cut(s) 71, 266
SduI GDGCHC 1 cut(s) 111
SetI ASST 5 cut(s) 67, 81, 101, 150, 231
SspI AATATT 1 cut(s) 172
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 2 cut(s) 69, 264
TaqI TCGA 1 cut(s) 42
TfiI GAWTC 2 cut(s) 21, 215
Tru1I TTAA 2 cut(s) 102, 168
Tru9I TTAA 2 cut(s) 102, 168
TspDTI ATGAA 3 cut(s) 13, 105, 285
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.