RchiOBHm_Chr1g0344371
ERF Family

Belongs to the protein kinase superfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Reverse (-)
36687305 .. 36688100
796 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57083

Sequence Viewer

Length: 345 bp
ATGATAGATCCTCGACTTGGAAGCAGTTATTTTAGCAGTGCAGCAAGAAAAATTGCCAAGTTGGCTGATAGTTGTCTGTCAAAGAGTGCAAAAGACCGGCCAACAATGAGTCAGGTGGTAGAAACATTGAAGCAGATTATCCAAGACTCAGAAGAAGGAAACCGATCCGAGAGAAGTCCTGAATCTTTAGAAAGTGACCAAGTTGACTCCGGGACAAAGGAGAAGCAATTAGGGGCCTCAGAGTCGTGGAAAAGACGAATGACTCACCTGGCGAAACTAGGAGAGCATGTGGAGGGTGCTAGTAGAAGAAGATTCATGATTATGCAGAGGGCAAAGGTGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

114

Amino Acids

12.79

Weight (kDa)

9.6

Isoelectric Point (pI)

67.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 2, 159
AcoI YGGCCR 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 1 cut(s) 130
AjnI CCWGG 1 cut(s) 267
AlwI GGATC 2 cut(s) 2, 159
AoxI GGCC 2 cut(s) 98, 234
ApeKI GCWGC 1 cut(s) 41
AspS9I GGNCC 1 cut(s) 234
AsuC2I CCSGG 1 cut(s) 211
AsuHPI GGTGA 1 cut(s) 257
BbvI GCAGC 1 cut(s) 53
BciT130I CCWGG 1 cut(s) 269
BcnI CCSGG 1 cut(s) 211
BfaI CTAG 2 cut(s) 278, 300
BglI GCCNNNNNGGC 1 cut(s) 62
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
Bme1390I CCNGG 2 cut(s) 211, 269
BmgT120I GGNCC 1 cut(s) 234
BmiI GGNNCC 1 cut(s) 235
BmrFI CCNGG 2 cut(s) 211, 269
BpuMI CCSGG 1 cut(s) 211
BsaXI ACNNNNNCTCC 2 cut(s) 273, 303
Bsc4I CCNNNNNNNGG 1 cut(s) 17
Bse118I RCCGGY 1 cut(s) 96
BseBI CCWGG 1 cut(s) 269
BseLI CCNNNNNNNGG 1 cut(s) 17
BseMII CTCAG 2 cut(s) 162, 252
BseXI GCAGC 1 cut(s) 53
BsgI GTGCAG 1 cut(s) 60
BshFI GGCC 2 cut(s) 100, 236
BsiSI CCGG 2 cut(s) 97, 210
BslFI GGGAC 1 cut(s) 226
BslI CCNNNNNNNGG 1 cut(s) 17
BsmFI GGGAC 1 cut(s) 226
BsnI GGCC 2 cut(s) 100, 236
Bsp143I GATC 2 cut(s) 7, 164
BspANI GGCC 2 cut(s) 100, 236
BspCNI CTCAG 2 cut(s) 161, 251
BspHI TCATGA 1 cut(s) 315
BspLI GGNNCC 1 cut(s) 235
BspPI GGATC 2 cut(s) 2, 159
BsrFI RCCGGY 1 cut(s) 96
BssAI RCCGGY 1 cut(s) 96
BssMI GATC 2 cut(s) 7, 164
Bst2UI CCWGG 1 cut(s) 269
BstDEI CTNAG 2 cut(s) 148, 238
BstKTI GATC 2 cut(s) 10, 167
BstMBI GATC 2 cut(s) 7, 164
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstNI CCWGG 1 cut(s) 269
BstNSI RCATGY 1 cut(s) 290
BstSCI CCNGG 2 cut(s) 209, 267
BstV1I GCAGC 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 7
BstYI RGATCY 1 cut(s) 7
BsuRI GGCC 2 cut(s) 100, 236
BtsI GCAGTG 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 43
CciI TCATGA 1 cut(s) 315
Cfr10I RCCGGY 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 234
CviAII CATG 2 cut(s) 287, 316
CviJI RGCY 3 cut(s) 65, 100, 236
CviKI_1 RGCY 3 cut(s) 65, 100, 236
DdeI CTNAG 2 cut(s) 148, 238
DpnI GATC 2 cut(s) 9, 166
DpnII GATC 2 cut(s) 7, 164
EaeI YGGCCR 1 cut(s) 98
EcoO109I RGGNCCY 1 cut(s) 234
EcoRII CCWGG 1 cut(s) 267
FaeI CATG 2 cut(s) 290, 319
FaiI YATR 3 cut(s) 288, 317, 323
FaqI GGGAC 1 cut(s) 226
FatI CATG 2 cut(s) 286, 315
Fnu4HI GCNGC 1 cut(s) 42
Fsp4HI GCNGC 1 cut(s) 42
FspBI CTAG 2 cut(s) 278, 300
GluI GCNGC 1 cut(s) 42
HaeIII GGCC 2 cut(s) 100, 236
HapII CCGG 2 cut(s) 97, 210
Hin1II CATG 2 cut(s) 290, 319
HincII GTYRAC 1 cut(s) 205
HindII GTYRAC 1 cut(s) 205
HinfI GANTC 7 cut(s) 109, 146, 182, 206, 242, 262, 312
HpaII CCGG 2 cut(s) 97, 210
HphI GGTGA 1 cut(s) 257
Hpy166II GTNNAC 1 cut(s) 205
Hpy188I TCNGA 3 cut(s) 151, 169, 241
Hpy188III TCNNGA 2 cut(s) 179, 316
Hpy8I GTNNAC 1 cut(s) 205
HpyAV CCTTC 1 cut(s) 149
HpyCH4V TGCA 3 cut(s) 41, 89, 325
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
HpyF3I CTNAG 2 cut(s) 148, 238
Hsp92II CATG 2 cut(s) 290, 319
Kzo9I GATC 2 cut(s) 7, 164
LpnPI CCDG 6 cut(s) 98, 110, 192, 223, 254, 281
Lsp1109I GCAGC 1 cut(s) 53
MaeI CTAG 2 cut(s) 278, 300
MaeIII GTNAC 2 cut(s) 194, 337
MalI GATC 2 cut(s) 9, 166
MboI GATC 2 cut(s) 7, 164
MboII GAAGA 3 cut(s) 164, 318, 321
MflI RGATCY 1 cut(s) 7
MluCI AATT 2 cut(s) 51, 227
MlyI GAGTC 5 cut(s) 118, 140, 200, 251, 256
MnlI CCTC 4 cut(s) 21, 247, 286, 321
MslI CAYNNNNRTG 1 cut(s) 320
MspI CCGG 2 cut(s) 97, 210
MspR9I CCNGG 2 cut(s) 211, 269
MvaI CCWGG 1 cut(s) 269
MwoI GCNNNNNNNGC 1 cut(s) 62
NciI CCSGG 1 cut(s) 211
NdeII GATC 2 cut(s) 7, 164
NlaIII CATG 2 cut(s) 290, 319
NlaIV GGNNCC 1 cut(s) 235
NmuCI GTSAC 2 cut(s) 194, 337
NspI RCATGY 1 cut(s) 290
PagI TCATGA 1 cut(s) 315
PfeI GAWTC 2 cut(s) 182, 312
PfoI TCCNGGA 1 cut(s) 209
PkrI GCNGC 1 cut(s) 43
PleI GAGTC 5 cut(s) 117, 140, 200, 250, 256
PpsI GAGTC 5 cut(s) 117, 140, 200, 250, 256
Psp6I CCWGG 1 cut(s) 267
PspGI CCWGG 1 cut(s) 267
PspN4I GGNNCC 1 cut(s) 235
PspPI GGNCC 1 cut(s) 234
PsuI RGATCY 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 320
SatI GCNGC 1 cut(s) 42
Sau3AI GATC 2 cut(s) 7, 164
Sau96I GGNCC 1 cut(s) 234
SchI GAGTC 5 cut(s) 118, 140, 200, 251, 256
ScrFI CCNGG 2 cut(s) 211, 269
SetI ASST 3 cut(s) 117, 270, 339
SmiMI CAYNNNNRTG 1 cut(s) 320
Sse9I AATT 2 cut(s) 51, 227
SspMI CTAG 2 cut(s) 278, 300
StyD4I CCNGG 2 cut(s) 209, 267
TaqI TCGA 1 cut(s) 13
TasI AATT 2 cut(s) 51, 227
TfiI GAWTC 2 cut(s) 182, 312
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 2 cut(s) 194, 337
TseI GCWGC 1 cut(s) 41
Tsp45I GTSAC 2 cut(s) 194, 337
TspDTI ATGAA 1 cut(s) 304
TspRI CASTG 1 cut(s) 43
XceI RCATGY 1 cut(s) 290
XspI CTAG 2 cut(s) 278, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.