RchiOBHm_Chr1g0362261

resistance protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
N/A
Physical Location & Seq
Forward (+)
53934845 .. 53935120
276 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58709

Sequence Viewer

Length: 276 bp
ATGAGTGGCACTGGCATAAGAGAGCTACCATCCTCTATTGGAATGCTTGAAGGTCTTACTTTGCTAAACTTGAGAGATTGCAAAGAACTTTTGAGTATCCCGACGAGTTTATCAGGCGTAAAATCTCTCAAAGTTCTTAATCTTTCTGGTTGTTCGAAGCTTGAGAAACTGCCGGAAGAGTTGGGTCATGCAGAGAGTTTGGAGAGGCTTGATATGAGTGGAACTGCCATAAGAGAACCGCCTAGCTTCCAGCCTTTCTCTTTTGAGAAATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

9.85

Weight (kDa)

5.36

Isoelectric Point (pI)

40.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 2 - 73 2.5e-08 Leucine-rich repeat region
LRR_8 PF13855 18 - 77 9.7e-06 Leucine rich repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 239
AgsI TTSAA 1 cut(s) 50
AluBI AGCT 3 cut(s) 25, 160, 246
AluI AGCT 3 cut(s) 25, 160, 246
AsuII TTCGAA 1 cut(s) 155
BccI CCATC 1 cut(s) 37
BciVI GTATCC 1 cut(s) 107
BfaI CTAG 1 cut(s) 243
BfuI GTATCC 1 cut(s) 107
Bpu14I TTCGAA 1 cut(s) 155
BpuEI CTTGAG 2 cut(s) 91, 182
Bse1I ACTGG 1 cut(s) 16
BseGI GGATG 1 cut(s) 29
BseNI ACTGG 1 cut(s) 16
BsiSI CCGG 1 cut(s) 173
BsmI GAATGC 1 cut(s) 48
Bsp119I TTCGAA 1 cut(s) 155
BspACI CCGC 1 cut(s) 239
BspT104I TTCGAA 1 cut(s) 155
BsrI ACTGG 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 171
BstBI TTCGAA 1 cut(s) 155
BstF5I GGATG 1 cut(s) 29
BsuI GTATCC 1 cut(s) 107
BtsCI GGATG 1 cut(s) 29
BtsIMutI CAGTG 1 cut(s) 9
CviAII CATG 1 cut(s) 188
CviJI RGCY 5 cut(s) 25, 160, 208, 246, 253
CviKI_1 RGCY 5 cut(s) 25, 160, 208, 246, 253
Eam1104I CTCTTC 1 cut(s) 171
EarI CTCTTC 1 cut(s) 171
FaeI CATG 1 cut(s) 191
FaiI YATR 4 cut(s) 17, 189, 215, 230
FatI CATG 1 cut(s) 187
FokI GGATG 1 cut(s) 16
FspBI CTAG 1 cut(s) 243
HapII CCGG 1 cut(s) 173
Hin1II CATG 1 cut(s) 191
HindIII AAGCTT 1 cut(s) 158
HpaII CCGG 1 cut(s) 173
Hpy188III TCNNGA 1 cut(s) 100
Hpy99I CGWCG 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 44
HpyCH4V TGCA 2 cut(s) 81, 191
Hsp92II CATG 1 cut(s) 191
LpnPI CCDG 4 cut(s) 99, 132, 186, 263
MaeI CTAG 1 cut(s) 243
MboII GAAGA 1 cut(s) 188
MnlI CCTC 2 cut(s) 43, 198
MseI TTAA 2 cut(s) 138, 274
MspI CCGG 1 cut(s) 173
Mva1269I GAATGC 1 cut(s) 48
NlaIII CATG 1 cut(s) 191
NspV TTCGAA 1 cut(s) 155
PctI GAATGC 1 cut(s) 48
SaqAI TTAA 2 cut(s) 138, 274
SetI ASST 4 cut(s) 27, 55, 162, 248
SfuI TTCGAA 1 cut(s) 155
SmlI CTYRAG 2 cut(s) 70, 161
SmoI CTYRAG 2 cut(s) 70, 161
SsiI CCGC 1 cut(s) 239
SspMI CTAG 1 cut(s) 243
TaqI TCGA 1 cut(s) 155
Tru1I TTAA 2 cut(s) 138, 274
Tru9I TTAA 2 cut(s) 138, 274
TscAI CASTG 1 cut(s) 16
TspRI CASTG 1 cut(s) 16
XspI CTAG 1 cut(s) 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.