RchiOBHm_Chr2g0108221

L-type lectin-domain containing receptor kinase IX.1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
19685654 .. 19686118
465 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48215

Sequence Viewer

Length: 369 bp
ATGCCTAATAGTACCCTTTACACACATCTATTTGGCTCTAGGGAAATCTTGAATTGGGGCTTTCGGTATAACATAGCTTTAGGCTTGGCCTCGGCACTTCATTATCTATATGAGAATGCAGAGCAGTGTGTCCCTTATACGAATGCCAAATCAGCTAATGTTCTGTTGGACAACGATTTTAACACTAAACTGGGTGACTTTGGGATTGCTAATCTTGTACGTGGATCTGTGTTTAAGACTACAGGGGTAGTCGAGACTTTAGGATACATGGCTCCAGAATATGTTAATGAAGGGAGGGCAAGCAAAGAATCAAACATATTTAGCTTCGGAGTTGTGGCCTTAGAAATATTTTGTGGAAGGAGGACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lectin_legB Pkinase

Protein Analysis

122

Amino Acids

13.54

Weight (kDa)

6.07

Isoelectric Point (pI)

34.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 1 - 118 4.1e-15 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 24 - 120 1.3e-18 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 232
AfaI GTAC 2 cut(s) 13, 219
AgsI TTSAA 1 cut(s) 52
AluBI AGCT 3 cut(s) 77, 155, 324
AluI AGCT 3 cut(s) 77, 155, 324
Alw26I GTCTC 1 cut(s) 248
AlwI GGATC 1 cut(s) 232
AoxI GGCC 2 cut(s) 87, 336
AsuHPI GGTGA 1 cut(s) 206
BciVI GTATCC 1 cut(s) 257
BcoDI GTCTC 1 cut(s) 248
BfaI CTAG 1 cut(s) 39
BfmI CTRYAG 1 cut(s) 240
BfuI GTATCC 1 cut(s) 257
BmiI GGNNCC 1 cut(s) 273
BmrI ACTGGG 1 cut(s) 200
BmuI ACTGGG 1 cut(s) 200
BpmI CTGGAG 1 cut(s) 258
BsaAI YACGTR 1 cut(s) 221
BsaJI CCNNGG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 195
BshFI GGCC 2 cut(s) 89, 338
BslFI GGGAC 1 cut(s) 116
BsmAI GTCTC 1 cut(s) 248
BsmFI GGGAC 1 cut(s) 116
BsmI GAATGC 2 cut(s) 121, 148
BsnI GGCC 2 cut(s) 89, 338
Bsp143I GATC 1 cut(s) 224
BspANI GGCC 2 cut(s) 89, 338
BspLI GGNNCC 1 cut(s) 273
BspPI GGATC 1 cut(s) 232
BsrI ACTGG 1 cut(s) 195
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 1 cut(s) 224
BstBAI YACGTR 1 cut(s) 221
BstC8I GCNNGC 1 cut(s) 301
BstDEI CTNAG 2 cut(s) 340, 366
BstKTI GATC 1 cut(s) 227
BstMAI GTCTC 1 cut(s) 248
BstMBI GATC 1 cut(s) 224
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstSFI CTRYAG 1 cut(s) 240
BstX2I RGATCY 1 cut(s) 224
BstYI RGATCY 1 cut(s) 224
BsuI GTATCC 1 cut(s) 257
BsuRI GGCC 2 cut(s) 89, 338
BtsI GCAGTG 1 cut(s) 131
BtsIMutI CAGTG 1 cut(s) 131
Cac8I GCNNGC 1 cut(s) 301
Csp6I GTAC 2 cut(s) 12, 218
CviAII CATG 1 cut(s) 268
CviJI RGCY 9 cut(s) 36, 60, 77, 84, 89, 155, 272, 324, 338
CviKI_1 RGCY 9 cut(s) 36, 60, 77, 84, 89, 155, 272, 324, 338
CviQI GTAC 2 cut(s) 12, 218
DdeI CTNAG 2 cut(s) 340, 366
DpnI GATC 1 cut(s) 226
DpnII GATC 1 cut(s) 224
FaeI CATG 1 cut(s) 271
FaiI YATR 8 cut(s) 69, 74, 109, 111, 138, 269, 282, 317
FalI AAGNNNNNCTT 1 cut(s) 349
FaqI GGGAC 1 cut(s) 116
FatI CATG 1 cut(s) 267
FspBI CTAG 1 cut(s) 39
GsuI CTGGAG 1 cut(s) 258
HaeIII GGCC 2 cut(s) 89, 338
Hin1II CATG 1 cut(s) 271
HinfI GANTC 1 cut(s) 308
HphI GGTGA 1 cut(s) 206
Hpy188I TCNGA 1 cut(s) 329
Hpy188III TCNNGA 3 cut(s) 49, 253, 275
HpyAV CCTTC 2 cut(s) 284, 351
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 1 cut(s) 119
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpyF3I CTNAG 2 cut(s) 340, 366
HpySE526I ACGT 1 cut(s) 220
Hsp92II CATG 1 cut(s) 271
Kzo9I GATC 1 cut(s) 224
LmnI GCTCC 1 cut(s) 277
LpnPI CCDG 3 cut(s) 176, 228, 288
MaeI CTAG 1 cut(s) 39
MaeII ACGT 1 cut(s) 220
MaeIII GTNAC 1 cut(s) 194
MalI GATC 1 cut(s) 226
MboI GATC 1 cut(s) 224
MflI RGATCY 1 cut(s) 224
MluCI AATT 1 cut(s) 52
MmeI TCCRAC 1 cut(s) 147
MnlI CCTC 3 cut(s) 100, 288, 354
MseI TTAA 3 cut(s) 180, 234, 285
Mva1269I GAATGC 2 cut(s) 121, 148
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 224
NlaIII CATG 1 cut(s) 271
NlaIV GGNNCC 1 cut(s) 273
NmeAIII GCCGAG 1 cut(s) 71
NmuCI GTSAC 1 cut(s) 194
PctI GAATGC 2 cut(s) 121, 148
PfeI GAWTC 1 cut(s) 308
Ppu21I YACGTR 1 cut(s) 221
PspN4I GGNNCC 1 cut(s) 273
PsuI RGATCY 1 cut(s) 224
RsaI GTAC 2 cut(s) 13, 219
RsaNI GTAC 2 cut(s) 12, 218
SaqAI TTAA 3 cut(s) 180, 234, 285
Sau3AI GATC 1 cut(s) 224
SetI ASST 4 cut(s) 79, 157, 223, 326
SfcI CTRYAG 1 cut(s) 240
Sse9I AATT 1 cut(s) 52
SspI AATATT 1 cut(s) 348
SspMI CTAG 1 cut(s) 39
TaiI ACGT 1 cut(s) 223
TaqI TCGA 1 cut(s) 252
TasI AATT 1 cut(s) 52
TfiI GAWTC 1 cut(s) 308
Tru1I TTAA 3 cut(s) 180, 234, 285
Tru9I TTAA 3 cut(s) 180, 234, 285
TscAI CASTG 1 cut(s) 131
TseFI GTSAC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 194
TspDTI ATGAA 2 cut(s) 89, 303
TspRI CASTG 1 cut(s) 131
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.