RchiOBHm_Chr2g0113331

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Reverse (-)
25504941 .. 25508554
3614 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48668

Sequence Viewer

Length: 129 bp
ATGTGTAGAACCACTGAATACATGGCTCCTGAAATTCTGCTGTCTAAAGGCCACAACAAAGATGCAGATTGGTGGAGCATTGGTATACTTTTGTATGAGATGCTAAGTGGTCAGTTTAATTCTCTCTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

42

Amino Acids

4.86

Weight (kDa)

4.9

Isoelectric Point (pI)

51.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 2 - 38 6.5e-12 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 5 - 37 7.3e-06 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 85
AcsI RAATTY 1 cut(s) 33
AoxI GGCC 1 cut(s) 49
ApoI RAATTY 1 cut(s) 33
BmiI GGNNCC 1 cut(s) 27
BmsI GCATC 2 cut(s) 52, 90
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
BshFI GGCC 1 cut(s) 51
BsnI GGCC 1 cut(s) 51
BspANI GGCC 1 cut(s) 51
BspLI GGNNCC 1 cut(s) 27
BssNAI GTATAC 1 cut(s) 86
Bst1107I GTATAC 1 cut(s) 86
BstDEI CTNAG 1 cut(s) 104
BstZ17I GTATAC 1 cut(s) 86
BsuRI GGCC 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 12
CviAII CATG 1 cut(s) 22
CviJI RGCY 2 cut(s) 26, 51
CviKI_1 RGCY 2 cut(s) 26, 51
DdeI CTNAG 1 cut(s) 104
FaeI CATG 1 cut(s) 25
FaiI YATR 3 cut(s) 23, 86, 96
FatI CATG 1 cut(s) 21
FblI GTMKAC 1 cut(s) 85
FspEI CC 9 cut(s) 8, 25, 33, 42, 55, 58, 65, 66, 93
HaeIII GGCC 1 cut(s) 51
Hin1II CATG 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 128
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 1 cut(s) 86
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 1 cut(s) 25
LmnI GCTCC 2 cut(s) 31, 75
LpnPI CCDG 1 cut(s) 42
LweI GCATC 2 cut(s) 52, 90
MluCI AATT 2 cut(s) 33, 118
MseI TTAA 1 cut(s) 117
NlaIII CATG 1 cut(s) 25
NlaIV GGNNCC 1 cut(s) 27
PspN4I GGNNCC 1 cut(s) 27
SaqAI TTAA 1 cut(s) 117
SfaNI GCATC 2 cut(s) 52, 90
SgeI CNNG 2 cut(s) 34, 41
Sse9I AATT 2 cut(s) 33, 118
TasI AATT 2 cut(s) 33, 118
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TscAI CASTG 1 cut(s) 19
TspRI CASTG 1 cut(s) 19
XapI RAATTY 1 cut(s) 33
XcmI CCANNNNNNNNNTGG 1 cut(s) 19
XmiI GTMKAC 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.