RchiOBHm_Chr2g0165411

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
N/A
Physical Location & Seq
Forward (+)
80379239 .. 80379487
249 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53337

Sequence Viewer

Length: 249 bp
ATGGGTAATATCACAATGTCCAAGACCCAGATTAGCACGAAGGTGAAGGGTAGTTTCAGATATTTTGACCCTGATTACTACCGATGTCAACAATTAATTGAGAAGTCCGATGTGGACTCATTTAGTGTAGTTTTATGCGAAGTATTGTGTGGGAGGTCAACTGTGACCATTGTGGATAATGATCGAGTTGGCTTGGCTAGATGGGCTAAAAGGTGTCATCGCAATGGGAAACTTGATCAGATTGTTTGA

Protein Analysis

82

Amino Acids

9.39

Weight (kDa)

9.04

Isoelectric Point (pI)

31.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AleI CACNNNNGTG 1 cut(s) 41
AseI ATTAAT 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 55
BccI CCATC 1 cut(s) 195
BclI TGATCA 1 cut(s) 235
BfaI CTAG 1 cut(s) 198
BsaBI GATNNNNATC 1 cut(s) 180
Bse3DI GCAATG 1 cut(s) 229
Bse8I GATNNNNATC 1 cut(s) 180
BseJI GATNNNNATC 1 cut(s) 180
BseMI GCAATG 1 cut(s) 229
Bsp143I GATC 2 cut(s) 181, 235
BsrDI GCAATG 1 cut(s) 229
BssMI GATC 2 cut(s) 181, 235
Bst4CI ACNGT 1 cut(s) 163
BstKTI GATC 2 cut(s) 184, 238
BstMBI GATC 2 cut(s) 181, 235
BstMWI GCNNNNNNNGC 1 cut(s) 203
BtgZI GCGATG 1 cut(s) 203
CviJI RGCY 3 cut(s) 192, 197, 206
CviKI_1 RGCY 3 cut(s) 192, 197, 206
DpnI GATC 2 cut(s) 183, 237
DpnII GATC 2 cut(s) 181, 235
FaiI YATR 1 cut(s) 136
FbaI TGATCA 1 cut(s) 235
FspBI CTAG 1 cut(s) 198
HincII GTYRAC 2 cut(s) 89, 159
HindII GTYRAC 2 cut(s) 89, 159
HinfI GANTC 1 cut(s) 116
HphI GGTGA 1 cut(s) 55
Hpy166II GTNNAC 3 cut(s) 89, 115, 159
Hpy188I TCNGA 3 cut(s) 59, 109, 240
Hpy8I GTNNAC 3 cut(s) 89, 115, 159
HpyAV CCTTC 2 cut(s) 34, 40
HpyCH4III ACNGT 1 cut(s) 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
Ksp22I TGATCA 1 cut(s) 235
Kzo9I GATC 2 cut(s) 181, 235
LpnPI CCDG 2 cut(s) 41, 84
MaeI CTAG 1 cut(s) 198
MaeIII GTNAC 1 cut(s) 163
MalI GATC 2 cut(s) 183, 237
MboI GATC 2 cut(s) 181, 235
MluCI AATT 2 cut(s) 92, 96
MlyI GAGTC 1 cut(s) 110
MnlI CCTC 1 cut(s) 147
MseI TTAA 1 cut(s) 95
MslI CAYNNNNRTG 2 cut(s) 41, 222
MwoI GCNNNNNNNGC 1 cut(s) 203
NdeII GATC 2 cut(s) 181, 235
NmuCI GTSAC 1 cut(s) 163
OliI CACNNNNGTG 1 cut(s) 41
PleI GAGTC 1 cut(s) 110
PpsI GAGTC 1 cut(s) 110
PshBI ATTAAT 1 cut(s) 95
RseI CAYNNNNRTG 2 cut(s) 41, 222
SaqAI TTAA 1 cut(s) 95
Sau3AI GATC 2 cut(s) 181, 235
SchI GAGTC 1 cut(s) 110
SetI ASST 3 cut(s) 45, 158, 215
SgeI CNNG 8 cut(s) 34, 40, 49, 83, 197, 205, 210, 245
SmiMI CAYNNNNRTG 2 cut(s) 41, 222
Sse9I AATT 2 cut(s) 92, 96
SspMI CTAG 1 cut(s) 198
TaaI ACNGT 1 cut(s) 163
TaqI TCGA 1 cut(s) 184
TasI AATT 2 cut(s) 92, 96
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TseFI GTSAC 1 cut(s) 163
Tsp45I GTSAC 1 cut(s) 163
VspI ATTAAT 1 cut(s) 95
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.