RchiOBHm_Chr3g0459551

Leucine-rich repeat receptor-like protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
N/A
Physical Location & Seq
Reverse (-)
7969023 .. 7969386
364 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42614

Sequence Viewer

Length: 279 bp
ATGCCACTGGTCTCTAAACATACCCAATTCTATTGTCTACGTCTAGGTCATTTTGAATCAGAAATCGCCTCTCTTTCTCTCTCTTTGGATCTCAACCTCAACCTCGTCATTGCCGTGCTCCTCTCTCATCTCGGAGACGACGACCTTCCGCCATGGTCCGGTGTCACTTGCTCCACTCAAGGCGATTACCGAGTCGTCACTAAGGAGGTTTATGGAGTCTCAACTGTTGGGCGTTGTCCTACTATCGTCACTAATCTATTAGATCTCACTAGGTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_4 LRR_6 LRR_8

Protein Analysis

92

Amino Acids

10.12

Weight (kDa)

5.37

Isoelectric Point (pI)

20.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 277
AccI GTMKAC 1 cut(s) 37
AciI CCGC 1 cut(s) 149
AclWI GGATC 1 cut(s) 96
AfiI CCNNNNNNNGG 1 cut(s) 158
AgsI TTSAA 1 cut(s) 56
Alw21I GWGCWC 1 cut(s) 120
Alw26I GTCTC 3 cut(s) 16, 129, 223
AlwI GGATC 1 cut(s) 96
AspS9I GGNCC 1 cut(s) 156
AvaII GGWCC 1 cut(s) 156
Bbv12I GWGCWC 1 cut(s) 120
BceAI ACGGC 1 cut(s) 98
BcoDI GTCTC 3 cut(s) 16, 129, 223
BfaI CTAG 2 cut(s) 44, 270
BglII AGATCT 1 cut(s) 262
Bme18I GGWCC 1 cut(s) 156
BmgT120I GGNCC 1 cut(s) 156
BpuEI CTTGAG 1 cut(s) 162
BsaI GGTCTC 1 cut(s) 16
BsaJI CCNNGG 1 cut(s) 152
BsaWI WCCGGW 1 cut(s) 158
Bsc4I CCNNNNNNNGG 1 cut(s) 158
Bse1I ACTGG 1 cut(s) 12
Bse3DI GCAATG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 152
BseLI CCNNNNNNNGG 1 cut(s) 158
BseMI GCAATG 1 cut(s) 108
BseNI ACTGG 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 110
BsiHKAI GWGCWC 1 cut(s) 120
BsiSI CCGG 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 158
BsmAI GTCTC 3 cut(s) 16, 129, 223
BsmBI CGTCTC 1 cut(s) 129
Bso31I GGTCTC 1 cut(s) 16
Bsp1286I GDGCHC 1 cut(s) 120
Bsp143I GATC 2 cut(s) 88, 262
Bsp19I CCATGG 1 cut(s) 152
BspACI CCGC 1 cut(s) 149
BspPI GGATC 1 cut(s) 96
BspTNI GGTCTC 1 cut(s) 16
BsrDI GCAATG 1 cut(s) 108
BsrI ACTGG 1 cut(s) 12
BssECI CCNNGG 1 cut(s) 152
BssMI GATC 2 cut(s) 88, 262
BssT1I CCWWGG 1 cut(s) 152
Bst4CI ACNGT 1 cut(s) 226
BstDEI CTNAG 1 cut(s) 201
BstDSI CCRYGG 1 cut(s) 152
BstKTI GATC 2 cut(s) 91, 265
BstMAI GTCTC 3 cut(s) 16, 129, 223
BstMBI GATC 2 cut(s) 88, 262
BstX2I RGATCY 2 cut(s) 88, 262
BstYI RGATCY 2 cut(s) 88, 262
BtgI CCRYGG 1 cut(s) 152
BtsIMutI CAGTG 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 156
CviAII CATG 1 cut(s) 153
DdeI CTNAG 1 cut(s) 201
DpnI GATC 2 cut(s) 90, 264
DpnII GATC 2 cut(s) 88, 262
EciI GGCGGA 1 cut(s) 138
Eco130I CCWWGG 1 cut(s) 152
Eco31I GGTCTC 1 cut(s) 16
Eco47I GGWCC 1 cut(s) 156
EcoT14I CCWWGG 1 cut(s) 152
ErhI CCWWGG 1 cut(s) 152
Esp3I CGTCTC 1 cut(s) 129
FaeI CATG 1 cut(s) 156
FaiI YATR 4 cut(s) 21, 154, 213, 277
FatI CATG 1 cut(s) 152
FblI GTMKAC 1 cut(s) 37
FspBI CTAG 2 cut(s) 44, 270
HapII CCGG 1 cut(s) 159
Hin1II CATG 1 cut(s) 156
HinfI GANTC 3 cut(s) 56, 192, 216
HpaII CCGG 1 cut(s) 159
Hpy166II GTNNAC 1 cut(s) 38
Hpy188I TCNGA 2 cut(s) 61, 134
Hpy8I GTNNAC 1 cut(s) 38
Hpy99I CGWCG 1 cut(s) 143
HpyAV CCTTC 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 226
HpyCH4IV ACGT 1 cut(s) 40
HpyF3I CTNAG 1 cut(s) 201
HpySE526I ACGT 1 cut(s) 40
Hsp92II CATG 1 cut(s) 156
Kzo9I GATC 2 cut(s) 88, 262
LmnI GCTCC 2 cut(s) 123, 176
LpnPI CCDG 1 cut(s) 172
MaeI CTAG 2 cut(s) 44, 270
MaeII ACGT 1 cut(s) 40
MaeIII GTNAC 3 cut(s) 163, 196, 247
MalI GATC 2 cut(s) 90, 264
MboI GATC 2 cut(s) 88, 262
MflI RGATCY 2 cut(s) 88, 262
MhlI GDGCHC 1 cut(s) 120
MluCI AATT 1 cut(s) 26
MlyI GAGTC 2 cut(s) 201, 225
MnlI CCTC 5 cut(s) 79, 107, 113, 131, 199
MslI CAYNNNNRTG 1 cut(s) 113
MspI CCGG 1 cut(s) 159
NcoI CCATGG 1 cut(s) 152
NdeII GATC 2 cut(s) 88, 262
NlaIII CATG 1 cut(s) 156
NmuCI GTSAC 3 cut(s) 163, 196, 247
PcsI WCGNNNNNNNCGW 2 cut(s) 111, 138
PfeI GAWTC 1 cut(s) 56
PleI GAGTC 2 cut(s) 200, 224
PpsI GAGTC 2 cut(s) 200, 224
PsiI TTATAA 1 cut(s) 277
PspPI GGNCC 1 cut(s) 156
PsuI RGATCY 2 cut(s) 88, 262
RseI CAYNNNNRTG 1 cut(s) 113
Sau3AI GATC 2 cut(s) 88, 262
Sau96I GGNCC 1 cut(s) 156
SchI GAGTC 2 cut(s) 201, 225
SduI GDGCHC 1 cut(s) 120
SetI ASST 7 cut(s) 43, 49, 99, 105, 147, 210, 275
SinI GGWCC 1 cut(s) 156
SmiMI CAYNNNNRTG 1 cut(s) 113
SmlI CTYRAG 1 cut(s) 177
SmoI CTYRAG 1 cut(s) 177
Sse9I AATT 1 cut(s) 26
SsiI CCGC 1 cut(s) 149
SspMI CTAG 2 cut(s) 44, 270
StyI CCWWGG 1 cut(s) 152
TaaI ACNGT 1 cut(s) 226
TaiI ACGT 1 cut(s) 43
TasI AATT 1 cut(s) 26
TfiI GAWTC 1 cut(s) 56
TscAI CASTG 1 cut(s) 12
TseFI GTSAC 3 cut(s) 163, 196, 247
Tsp45I GTSAC 3 cut(s) 163, 196, 247
TspRI CASTG 1 cut(s) 12
VpaK11BI GGWCC 1 cut(s) 156
XmiI GTMKAC 1 cut(s) 37
XspI CTAG 2 cut(s) 44, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.