RchiOBHm_Chr4g0405821

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
N/A
Physical Location & Seq
Reverse (-)
26578083 .. 26578283
201 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37728

Sequence Viewer

Length: 201 bp
ATGTTGTATGCAAGAGGAGGTACTGCTGGATACATTGCACCAGAGGTGTTCTGTAGAAACTTTGGAGGAATCTCGCACAAATCCGTTGTGTATAGTTATGGAATGATGCTTTCGGAGATGGTTGGAGGAAGAAGGAAAATAAATGTTGAAGTGGAAGATACTAGTGAGATATATTTTCCACACTGGATTTACAAGTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

66

Amino Acids

7.5

Weight (kDa)

7.89

Isoelectric Point (pI)

37.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 22
AgsI TTSAA 1 cut(s) 149
AhlI ACTAGT 1 cut(s) 161
BccI CCATC 1 cut(s) 112
BciVI GTATCC 1 cut(s) 23
BcuI ACTAGT 1 cut(s) 161
BfaI CTAG 1 cut(s) 162
BfmI CTRYAG 1 cut(s) 52
BfuI GTATCC 1 cut(s) 23
BmsI GCATC 1 cut(s) 96
Bse1I ACTGG 1 cut(s) 188
Bse3DI GCAATG 1 cut(s) 33
BseMI GCAATG 1 cut(s) 33
BseNI ACTGG 1 cut(s) 188
BseRI GAGGAG 1 cut(s) 30
BsrDI GCAATG 1 cut(s) 33
BsrI ACTGG 1 cut(s) 188
BstSFI CTRYAG 1 cut(s) 52
BsuI GTATCC 1 cut(s) 23
BtsIMutI CAGTG 1 cut(s) 181
Csp6I GTAC 1 cut(s) 21
CviQI GTAC 1 cut(s) 21
FaiI YATR 4 cut(s) 9, 93, 99, 172
FspBI CTAG 1 cut(s) 162
HinfI GANTC 1 cut(s) 69
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 198
HpyAV CCTTC 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 11, 38
LpnPI CCDG 3 cut(s) 12, 54, 169
LweI GCATC 1 cut(s) 96
MaeI CTAG 1 cut(s) 162
MboII GAAGA 2 cut(s) 141, 167
MmeI TCCRAC 1 cut(s) 103
MnlI CCTC 5 cut(s) 8, 11, 37, 59, 119
PfeI GAWTC 1 cut(s) 69
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
SetI ASST 2 cut(s) 22, 48
SfaNI GCATC 1 cut(s) 96
SfcI CTRYAG 1 cut(s) 52
SgeI CNNG 6 cut(s) 24, 39, 53, 85, 174, 196
SpeI ACTAGT 1 cut(s) 161
SspMI CTAG 1 cut(s) 162
TfiI GAWTC 1 cut(s) 69
TscAI CASTG 1 cut(s) 188
TspGWI ACGGA 1 cut(s) 73
TspRI CASTG 1 cut(s) 188
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.