RchiOBHm_Chr5g0033521

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
27352758 .. 27352987
230 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31259

Sequence Viewer

Length: 144 bp
ATGAACCCTAAAATTGCAGATTTTGGTATCACAAGATTGTTATTATGGATCAAACTCAAGGAGATACAAAGACCATTGTTGGGACCTAGTAATGGATATATGGCACCAGAATATGTAATTCATGGCCGCTTTTCTGTCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.41

Weight (kDa)

9.99

Isoelectric Point (pI)

28.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 103
AciI CCGC 1 cut(s) 127
AclWI GGATC 1 cut(s) 56
AcoI YGGCCR 1 cut(s) 124
AfiI CCNNNNNNNGG 2 cut(s) 80, 92
AlwI GGATC 1 cut(s) 56
AoxI GGCC 1 cut(s) 124
AspS9I GGNCC 1 cut(s) 83
AvaII GGWCC 1 cut(s) 83
BanI GGYRCC 1 cut(s) 103
BfaI CTAG 1 cut(s) 87
BisI GCNGC 1 cut(s) 127
BlsI GCNGC 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 83
BmgT120I GGNCC 1 cut(s) 83
BmiI GGNNCC 2 cut(s) 84, 105
BpuEI CTTGAG 1 cut(s) 41
Bsc4I CCNNNNNNNGG 2 cut(s) 80, 92
BseLI CCNNNNNNNGG 2 cut(s) 80, 92
BshFI GGCC 1 cut(s) 126
BshNI GGYRCC 1 cut(s) 103
BslFI GGGAC 1 cut(s) 96
BslI CCNNNNNNNGG 2 cut(s) 80, 92
BsmFI GGGAC 1 cut(s) 96
BsnI GGCC 1 cut(s) 126
Bsp143I GATC 1 cut(s) 48
BspACI CCGC 1 cut(s) 127
BspANI GGCC 1 cut(s) 126
BspLI GGNNCC 2 cut(s) 84, 105
BspPI GGATC 1 cut(s) 56
BspT107I GGYRCC 1 cut(s) 103
BssMI GATC 1 cut(s) 48
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BsuRI GGCC 1 cut(s) 126
Cfr13I GGNCC 1 cut(s) 83
CviAII CATG 1 cut(s) 122
CviJI RGCY 1 cut(s) 126
CviKI_1 RGCY 1 cut(s) 126
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
EaeI YGGCCR 1 cut(s) 124
Eco47I GGWCC 1 cut(s) 83
EcoO109I RGGNCCY 1 cut(s) 83
FaeI CATG 1 cut(s) 125
FaiI YATR 5 cut(s) 46, 99, 101, 114, 123
FaqI GGGAC 1 cut(s) 96
FatI CATG 1 cut(s) 121
Fnu4HI GCNGC 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 127
FspBI CTAG 1 cut(s) 87
GluI GCNGC 1 cut(s) 127
HaeIII GGCC 1 cut(s) 126
Hin1II CATG 1 cut(s) 125
HpyCH4V TGCA 1 cut(s) 17
Hsp92II CATG 1 cut(s) 125
Kzo9I GATC 1 cut(s) 48
LpnPI CCDG 1 cut(s) 120
MaeI CTAG 1 cut(s) 87
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MluCI AATT 2 cut(s) 12, 117
NdeII GATC 1 cut(s) 48
NlaIII CATG 1 cut(s) 125
NlaIV GGNNCC 2 cut(s) 84, 105
PkrI GCNGC 1 cut(s) 128
PpuMI RGGWCCY 1 cut(s) 83
Psp5II RGGWCCY 1 cut(s) 83
PspN4I GGNNCC 2 cut(s) 84, 105
PspPI GGNCC 1 cut(s) 83
PspPPI RGGWCCY 1 cut(s) 83
SatI GCNGC 1 cut(s) 127
Sau3AI GATC 1 cut(s) 48
Sau96I GGNCC 1 cut(s) 83
SetI ASST 1 cut(s) 88
SgeI CNNG 5 cut(s) 45, 70, 99, 119, 134
SinI GGWCC 1 cut(s) 83
SmlI CTYRAG 1 cut(s) 56
SmoI CTYRAG 1 cut(s) 56
Sse9I AATT 2 cut(s) 12, 117
SsiI CCGC 1 cut(s) 127
SspMI CTAG 1 cut(s) 87
TasI AATT 2 cut(s) 12, 117
TauI GCSGC 1 cut(s) 129
TspDTI ATGAA 2 cut(s) 17, 110
VpaK11BI GGWCC 1 cut(s) 83
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.