RchiOBHm_Chr5g0079531

Disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
N/A
Physical Location & Seq
Reverse (-)
85248496 .. 85250539
2044 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35393

Sequence Viewer

Length: 123 bp
ATGGATTCCCCCCAATTTTTATTTTCAACCTCTGCTTCTGACTACTCTCACGGCAGGAACCAAGTCCTTCTCAATGATCAACAACATTATGAGTCTCTAGCTGAGAGGATGTCCATCTGTTAA

Protein Analysis

40

Amino Acids

4.61

Weight (kDa)

4.8

Isoelectric Point (pI)

54.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 27
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw26I GTCTC 1 cut(s) 99
BccI CCATC 1 cut(s) 122
BceAI ACGGC 1 cut(s) 67
BclI TGATCA 1 cut(s) 76
BcoDI GTCTC 1 cut(s) 99
BfaI CTAG 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 59
BsaBI GATNNNNATC 1 cut(s) 113
Bse8I GATNNNNATC 1 cut(s) 113
BseGI GGATG 1 cut(s) 114
BseJI GATNNNNATC 1 cut(s) 113
BseMII CTCAG 1 cut(s) 93
BsmAI GTCTC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 76
BspCNI CTCAG 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 59
BssMI GATC 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 102
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 1 cut(s) 79
BstMAI GTCTC 1 cut(s) 99
BstMBI GATC 1 cut(s) 76
BtsCI GGATG 1 cut(s) 114
CviJI RGCY 1 cut(s) 101
CviKI_1 RGCY 1 cut(s) 101
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 78
DpnII GATC 1 cut(s) 76
FaiI YATR 1 cut(s) 90
FbaI TGATCA 1 cut(s) 76
FspBI CTAG 1 cut(s) 98
HinfI GANTC 2 cut(s) 5, 92
Hpy188I TCNGA 1 cut(s) 40
HpyAV CCTTC 1 cut(s) 77
HpyF3I CTNAG 1 cut(s) 102
Ksp22I TGATCA 1 cut(s) 76
Kzo9I GATC 1 cut(s) 76
LpnPI CCDG 1 cut(s) 40
MaeI CTAG 1 cut(s) 98
MalI GATC 1 cut(s) 78
MboI GATC 1 cut(s) 76
MluCI AATT 1 cut(s) 14
MlyI GAGTC 1 cut(s) 101
MnlI CCTC 2 cut(s) 40, 99
MseI TTAA 1 cut(s) 121
NdeII GATC 1 cut(s) 76
NlaIV GGNNCC 1 cut(s) 59
PfeI GAWTC 1 cut(s) 5
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 59
SaqAI TTAA 1 cut(s) 121
Sau3AI GATC 1 cut(s) 76
SchI GAGTC 1 cut(s) 101
SetI ASST 2 cut(s) 32, 103
SgeI CNNG 4 cut(s) 62, 67, 74, 110
Sse9I AATT 1 cut(s) 14
SspMI CTAG 1 cut(s) 98
TasI AATT 1 cut(s) 14
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 121
Tru9I TTAA 1 cut(s) 121
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.