RchiOBHm_Chr6g0251171

Receptor-like protein 12

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
N/A
Physical Location & Seq
Forward (+)
6493701 .. 6493889
189 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22518

Sequence Viewer

Length: 189 bp
ATGGACTTCTCTATTATGGATTTTGGCCACCATTCAATTAAAGCCAATATTCAATATGACGTTGGTTATAACCTATTGCAGGGGCAACTTCCAAGGTCATTGAAAAGTTGTGCAATGCTTGAGTATCTTAGACTGTCAAACAAGGCATTCACTGATGTTTTCCACTATTGGTTAGGAGTGCTCCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.19

Weight (kDa)

6.81

Isoelectric Point (pI)

48.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 69
AcoI YGGCCR 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 3 cut(s) 36, 53, 103
Alw21I GWGCWC 1 cut(s) 183
AoxI GGCC 1 cut(s) 25
BalI TGGCCA 1 cut(s) 27
Bbv12I GWGCWC 1 cut(s) 183
BpuEI CTTGAG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 92
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse3DI GCAATG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 92
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMI GCAATG 1 cut(s) 120
BshFI GGCC 1 cut(s) 27
BsiHKAI GWGCWC 1 cut(s) 183
BslI CCNNNNNNNGG 1 cut(s) 79
BsmI GAATGC 1 cut(s) 146
BsnI GGCC 1 cut(s) 27
Bsp1286I GDGCHC 1 cut(s) 183
BspANI GGCC 1 cut(s) 27
BsrDI GCAATG 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 92
BssT1I CCWWGG 1 cut(s) 92
Bst4CI ACNGT 1 cut(s) 135
BstDEI CTNAG 1 cut(s) 128
BstENI CCTNNNNNAGG 1 cut(s) 77
BsuRI GGCC 1 cut(s) 27
BtsIMutI CAGTG 1 cut(s) 150
CviJI RGCY 2 cut(s) 27, 44
CviKI_1 RGCY 2 cut(s) 27, 44
DdeI CTNAG 1 cut(s) 128
EaeI YGGCCR 1 cut(s) 25
Eco130I CCWWGG 1 cut(s) 92
EcoNI CCTNNNNNAGG 1 cut(s) 77
EcoT14I CCWWGG 1 cut(s) 92
ErhI CCWWGG 1 cut(s) 92
FaiI YATR 4 cut(s) 17, 57, 69, 187
HaeIII GGCC 1 cut(s) 27
HpyCH4III ACNGT 1 cut(s) 135
HpyCH4IV ACGT 1 cut(s) 60
HpyCH4V TGCA 2 cut(s) 79, 113
HpyF3I CTNAG 1 cut(s) 128
HpySE526I ACGT 1 cut(s) 60
LmnI GCTCC 1 cut(s) 186
LpnPI CCDG 1 cut(s) 65
MaeII ACGT 1 cut(s) 60
MhlI GDGCHC 1 cut(s) 183
MlsI TGGCCA 1 cut(s) 27
MluCI AATT 1 cut(s) 36
MluNI TGGCCA 1 cut(s) 27
Mox20I TGGCCA 1 cut(s) 27
MscI TGGCCA 1 cut(s) 27
MseI TTAA 1 cut(s) 39
Msp20I TGGCCA 1 cut(s) 27
Mva1269I GAATGC 1 cut(s) 146
PctI GAATGC 1 cut(s) 146
PsiI TTATAA 1 cut(s) 69
SaqAI TTAA 1 cut(s) 39
SduI GDGCHC 1 cut(s) 183
SetI ASST 3 cut(s) 63, 75, 98
SgeI CNNG 4 cut(s) 92, 105, 131, 154
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 1 cut(s) 36
SspI AATATT 1 cut(s) 49
StyI CCWWGG 1 cut(s) 92
TaaI ACNGT 1 cut(s) 135
TaiI ACGT 1 cut(s) 63
TasI AATT 1 cut(s) 36
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TscAI CASTG 1 cut(s) 157
TspRI CASTG 1 cut(s) 157
XagI CCTNNNNNAGG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.