RchiOBHm_Chr6g0283311

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
N/A
Physical Location & Seq
Reverse (-)
46522743 .. 46523722
980 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25401

Sequence Viewer

Length: 657 bp
ATGCAGCAAATATTCATATCTTCCTTTTGCTTATTCTCATTAATAATGACTTTCTTCAAAGTAACTGTAGCGTGTACAGAATTCAGCTGTGGGTATAATGGCCTGGCTATTCATCTCCCATTCCGCAGGGGAGATGATGAGCACCGAATTGTTCTAGGAAAATTCCTTGTCAAACACATAGATTATATCCGTCAGGAAATCCAACTAAGTACCCCAGACTGCCTTCTACTAACTTCTTTAGACAACTCCTACATGGACTTGCCAAGCTCTCCGTTCTACGCAGACGAAACTGTTAACCTTACCCTATTCCGTTGTCCTGTTCAAAGAGTTGTAGATAATGCAAGACTAGTCCCCTGCCTTGGTAACTACGCAGCTTATGCCGTTGAATCTTTCACATCCCCTGGGGATTACCCTGCCCTAGAGTCGTGTACAAAGATGTATGATTTATCACTTCTACACGGCAATGACTACACAGCTTCCTCAGAGCCTCGTCTTAGATGGTATAAACCAAACTGTTCAGAGTGCAAAGCAATGGGAAACAAGTGTAGATTGAAGAACAATGGCATTCAAAGTGAAATTGAATGCGTTCACCCCAGGAAACCAAATCCATATTACTTTAGTAAGAAAAAGATAGATGAAGAAGACAATGACGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

218

Amino Acids

24.96

Weight (kDa)

5.75

Isoelectric Point (pI)

65.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 124
AcsI RAATTY 2 cut(s) 80, 161
AfaI GTAC 3 cut(s) 76, 211, 430
AfiI CCNNNNNNNGG 1 cut(s) 359
AgsI TTSAA 6 cut(s) 58, 323, 386, 553, 569, 581
AhlI ACTAGT 1 cut(s) 346
AjnI CCWGG 3 cut(s) 102, 400, 593
AluBI AGCT 4 cut(s) 87, 267, 374, 476
AluI AGCT 4 cut(s) 87, 267, 374, 476
Alw21I GWGCWC 1 cut(s) 144
AoxI GGCC 1 cut(s) 100
ApeKI GCWGC 2 cut(s) 4, 371
ApoI RAATTY 2 cut(s) 80, 161
AseI ATTAAT 1 cut(s) 41
Asp700I GAANNNNTTC 1 cut(s) 585
AsuHPI GGTGA 1 cut(s) 581
BbsI GAAGAC 1 cut(s) 648
Bbv12I GWGCWC 1 cut(s) 144
BbvI GCAGC 2 cut(s) 16, 383
BccI CCATC 1 cut(s) 492
BceAI ACGGC 2 cut(s) 365, 475
BciT130I CCWGG 3 cut(s) 104, 402, 595
BcuI ACTAGT 1 cut(s) 346
BfaI CTAG 3 cut(s) 155, 347, 419
BfmI CTRYAG 1 cut(s) 66
BisI GCNGC 2 cut(s) 5, 372
BlsI GCNGC 2 cut(s) 6, 373
Bme1390I CCNGG 3 cut(s) 104, 402, 595
BmrFI CCNGG 3 cut(s) 104, 402, 595
BpiI GAAGAC 1 cut(s) 648
BsaJI CCNNGG 4 cut(s) 358, 400, 401, 593
Bsc4I CCNNNNNNNGG 1 cut(s) 359
Bse3DI GCAATG 2 cut(s) 469, 537
BseBI CCWGG 3 cut(s) 104, 402, 595
BseDI CCNNGG 4 cut(s) 358, 400, 401, 593
BseGI GGATG 1 cut(s) 395
BseLI CCNNNNNNNGG 1 cut(s) 359
BseMI GCAATG 2 cut(s) 469, 537
BseMII CTCAG 1 cut(s) 495
BseXI GCAGC 2 cut(s) 16, 383
BshFI GGCC 1 cut(s) 102
BsiHKAI GWGCWC 1 cut(s) 144
BslFI GGGAC 1 cut(s) 335
BslI CCNNNNNNNGG 1 cut(s) 359
BsmFI GGGAC 1 cut(s) 335
BsmI GAATGC 2 cut(s) 564, 587
BsnI GGCC 1 cut(s) 102
Bsp1286I GDGCHC 1 cut(s) 144
Bsp1407I TGTACA 2 cut(s) 74, 428
BspACI CCGC 1 cut(s) 124
BspANI GGCC 1 cut(s) 102
BspCNI CTCAG 1 cut(s) 494
BsrDI GCAATG 2 cut(s) 469, 537
BsrGI TGTACA 2 cut(s) 74, 428
BssECI CCNNGG 4 cut(s) 358, 400, 401, 593
BssT1I CCWWGG 1 cut(s) 358
Bst2UI CCWGG 3 cut(s) 104, 402, 595
Bst4CI ACNGT 3 cut(s) 67, 292, 515
BstAPI GCANNNNNTGC 1 cut(s) 377
BstAUI TGTACA 2 cut(s) 74, 428
BstDEI CTNAG 3 cut(s) 206, 481, 494
BstF5I GGATG 1 cut(s) 395
BstMWI GCNNNNNNNGC 1 cut(s) 377
BstNI CCWGG 3 cut(s) 104, 402, 595
BstSCI CCNGG 3 cut(s) 102, 400, 593
BstSFI CTRYAG 1 cut(s) 66
BstV1I GCAGC 2 cut(s) 16, 383
BstV2I GAAGAC 1 cut(s) 648
BsuRI GGCC 1 cut(s) 102
BtsCI GGATG 1 cut(s) 395
Csp6I GTAC 3 cut(s) 75, 210, 429
CviAII CATG 1 cut(s) 253
CviJI RGCY 7 cut(s) 87, 102, 107, 267, 374, 476, 487
CviKI_1 RGCY 7 cut(s) 87, 102, 107, 267, 374, 476, 487
CviQI GTAC 3 cut(s) 75, 210, 429
DdeI CTNAG 3 cut(s) 206, 481, 494
Eco130I CCWWGG 1 cut(s) 358
EcoRI GAATTC 1 cut(s) 80
EcoRII CCWGG 3 cut(s) 102, 400, 593
EcoT14I CCWWGG 1 cut(s) 358
ErhI CCWWGG 1 cut(s) 358
FaeI CATG 1 cut(s) 256
FaiI YATR 9 cut(s) 17, 96, 179, 186, 254, 378, 441, 504, 610
FaqI GGGAC 1 cut(s) 335
FatI CATG 1 cut(s) 252
Fnu4HI GCNGC 2 cut(s) 5, 372
FokI GGATG 1 cut(s) 382
Fsp4HI GCNGC 2 cut(s) 5, 372
FspBI CTAG 3 cut(s) 155, 347, 419
GluI GCNGC 2 cut(s) 5, 372
HaeIII GGCC 1 cut(s) 102
Hin1II CATG 1 cut(s) 256
HincII GTYRAC 1 cut(s) 295
HindII GTYRAC 1 cut(s) 295
HinfI GANTC 2 cut(s) 386, 422
HpaI GTTAAC 1 cut(s) 295
HphI GGTGA 1 cut(s) 581
Hpy166II GTNNAC 4 cut(s) 75, 295, 429, 589
Hpy188I TCNGA 2 cut(s) 484, 520
Hpy188III TCNNGA 1 cut(s) 194
Hpy8I GTNNAC 4 cut(s) 75, 295, 429, 589
HpyAV CCTTC 1 cut(s) 233
HpyCH4III ACNGT 3 cut(s) 67, 292, 515
HpyCH4V TGCA 3 cut(s) 4, 341, 525
HpyF10VI GCNNNNNNNGC 1 cut(s) 377
HpyF3I CTNAG 3 cut(s) 206, 481, 494
Hsp92II CATG 1 cut(s) 256
KspAI GTTAAC 1 cut(s) 295
Lsp1109I GCAGC 2 cut(s) 16, 383
MaeI CTAG 3 cut(s) 155, 347, 419
MaeIII GTNAC 2 cut(s) 61, 362
MboII GAAGA 5 cut(s) 12, 46, 565, 650, 653
MhlI GDGCHC 1 cut(s) 144
MluCI AATT 4 cut(s) 80, 147, 161, 576
MlyI GAGTC 1 cut(s) 431
MmeI TCCRAC 1 cut(s) 226
MnlI CCTC 2 cut(s) 490, 498
MroXI GAANNNNTTC 1 cut(s) 585
MseI TTAA 2 cut(s) 41, 294
MslI CAYNNNNRTG 1 cut(s) 462
MspA1I CMGCKG 1 cut(s) 87
MspR9I CCNGG 3 cut(s) 104, 402, 595
Mva1269I GAATGC 2 cut(s) 564, 587
MvaI CCWGG 3 cut(s) 104, 402, 595
MwoI GCNNNNNNNGC 1 cut(s) 377
NlaIII CATG 1 cut(s) 256
PasI CCCWGGG 1 cut(s) 401
PctI GAATGC 2 cut(s) 564, 587
PdmI GAANNNNTTC 1 cut(s) 585
PfeI GAWTC 1 cut(s) 386
PkrI GCNGC 2 cut(s) 6, 373
PleI GAGTC 1 cut(s) 430
PpsI GAGTC 1 cut(s) 430
PshBI ATTAAT 1 cut(s) 41
Psp6I CCWGG 3 cut(s) 102, 400, 593
PspGI CCWGG 3 cut(s) 102, 400, 593
PvuII CAGCTG 1 cut(s) 87
RsaI GTAC 3 cut(s) 76, 211, 430
RsaNI GTAC 3 cut(s) 75, 210, 429
RseI CAYNNNNRTG 1 cut(s) 462
SaqAI TTAA 2 cut(s) 41, 294
SatI GCNGC 2 cut(s) 5, 372
SchI GAGTC 1 cut(s) 431
ScrFI CCNGG 3 cut(s) 104, 402, 595
SduI GDGCHC 1 cut(s) 144
SetI ASST 5 cut(s) 89, 269, 300, 376, 478
SfcI CTRYAG 1 cut(s) 66
SmiMI CAYNNNNRTG 1 cut(s) 462
SpeI ACTAGT 1 cut(s) 346
Sse9I AATT 4 cut(s) 80, 147, 161, 576
SsiI CCGC 1 cut(s) 124
SspI AATATT 1 cut(s) 12
SspMI CTAG 3 cut(s) 155, 347, 419
StyD4I CCNGG 3 cut(s) 102, 400, 593
StyI CCWWGG 1 cut(s) 358
TaaI ACNGT 3 cut(s) 67, 292, 515
TasI AATT 4 cut(s) 80, 147, 161, 576
TatI WGTACW 2 cut(s) 74, 428
TfiI GAWTC 1 cut(s) 386
Tru1I TTAA 2 cut(s) 41, 294
Tru9I TTAA 2 cut(s) 41, 294
TseI GCWGC 2 cut(s) 4, 371
TspDTI ATGAA 3 cut(s) 4, 101, 651
TspGWI ACGGA 3 cut(s) 179, 261, 299
VspI ATTAAT 1 cut(s) 41
XapI RAATTY 2 cut(s) 80, 161
XmnI GAANNNNTTC 1 cut(s) 585
XspI CTAG 3 cut(s) 155, 347, 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.