RchiOBHm_Chr7g0217881

receptor-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
N/A
Physical Location & Seq
Forward (+)
35802480 .. 35804044
1565 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19501

Sequence Viewer

Length: 123 bp
ATGATCAACCTATTGGAAATATTGGACTATGAAATTTTTGCTGGCTATGTGTGCAAGGCTTACAAAGGTAACATTGTGCCCGTGGCATGTCAGTCTGTACATTTGAAGCAGAAGACAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

40

Amino Acids

4.54

Weight (kDa)

6.53

Isoelectric Point (pI)

63.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 33
AfaI GTAC 1 cut(s) 99
AgsI TTSAA 1 cut(s) 106
ApoI RAATTY 1 cut(s) 33
BaeGI GKGCMC 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 119
BclI TGATCA 1 cut(s) 3
BpiI GAAGAC 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 81
BseSI GKGCMC 1 cut(s) 81
Bsp1286I GDGCHC 1 cut(s) 81
Bsp1407I TGTACA 1 cut(s) 97
Bsp143I GATC 1 cut(s) 3
BsrGI TGTACA 1 cut(s) 97
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 3
BstAUI TGTACA 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 43
BstDSI CCRYGG 1 cut(s) 81
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 1 cut(s) 51
BstNSI RCATGY 1 cut(s) 90
BstSLI GKGCMC 1 cut(s) 81
BstV2I GAAGAC 1 cut(s) 119
BtgI CCRYGG 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 43
Csp6I GTAC 1 cut(s) 98
CviAII CATG 1 cut(s) 87
CviJI RGCY 2 cut(s) 45, 59
CviKI_1 RGCY 2 cut(s) 45, 59
CviQI GTAC 1 cut(s) 98
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
FaeI CATG 1 cut(s) 90
FaiI YATR 3 cut(s) 30, 48, 88
FatI CATG 1 cut(s) 86
FbaI TGATCA 1 cut(s) 3
FspEI CC 8 cut(s) 8, 23, 27, 41, 51, 68, 93, 94
Hin1II CATG 1 cut(s) 90
HpyCH4V TGCA 1 cut(s) 54
HpyF10VI GCNNNNNNNGC 1 cut(s) 51
Hsp92II CATG 1 cut(s) 90
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 1 cut(s) 27
MaeIII GTNAC 1 cut(s) 68
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MhlI GDGCHC 1 cut(s) 81
MluCI AATT 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 51
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 90
NspI RCATGY 1 cut(s) 90
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
Sau3AI GATC 1 cut(s) 3
SduI GDGCHC 1 cut(s) 81
SetI ASST 2 cut(s) 12, 70
SgeI CNNG 5 cut(s) 54, 67, 92, 94, 99
Sse9I AATT 1 cut(s) 33
SspI AATATT 1 cut(s) 21
TasI AATT 1 cut(s) 33
TatI WGTACW 1 cut(s) 97
TspDTI ATGAA 1 cut(s) 45
XapI RAATTY 1 cut(s) 33
XceI RCATGY 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.