RchiOBHm_Chr7g0224951

disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
N/A
Physical Location & Seq
Reverse (-)
47316892 .. 47317263
372 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20144

Sequence Viewer

Length: 372 bp
ATGATCCTTTTAGACAAGTTGAGGGATAGGGATTGTCTAGCATTGTTCAATAGCATCGCATTTTTGGATAGGGAAGAAGATGAGGCTAATGGGTTTGGAGCTATCGGTGAGGAAATTGTGAAAAAGTGTAAAGGTTTGCCTCTTACTGTAAAGACTTTAGGCAGTCTAGTGTGGCATAAGAAAACAAGAGAGGAATGGCGGGAGGTTCTGAATAGTAAGATATGGGAATTAGAAGAAGTTGAGGAACAAGTTTTCCGACCACTATTACTAAGTTATTCCGATTTAACTCCAGCAGTCAAGAGGTGTCTTTTGTATTGTGCTATATTTCTCAAAGATTATGAGTTAGGAAAAAATAATTTGATTGAGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

14.3

Weight (kDa)

5.13

Isoelectric Point (pI)

37.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 199
AgsI TTSAA 1 cut(s) 49
AloI GAACNNNNNNTCC 2 cut(s) 237, 269
AluBI AGCT 2 cut(s) 101, 367
AluI AGCT 2 cut(s) 101, 367
AsuHPI GGTGA 1 cut(s) 119
BfaI CTAG 2 cut(s) 38, 167
BmsI GCATC 1 cut(s) 63
BpmI CTGGAG 1 cut(s) 273
Bsp143I GATC 1 cut(s) 3
BspACI CCGC 1 cut(s) 199
BssMI GATC 1 cut(s) 3
Bst4CI ACNGT 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 269
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BtgZI GCGATG 1 cut(s) 40
CviJI RGCY 3 cut(s) 86, 101, 367
CviKI_1 RGCY 3 cut(s) 86, 101, 367
DdeI CTNAG 1 cut(s) 269
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
FaiI YATR 4 cut(s) 177, 223, 323, 339
FauI CCCGC 1 cut(s) 192
FspBI CTAG 2 cut(s) 38, 167
GsuI CTGGAG 1 cut(s) 273
HphI GGTGA 1 cut(s) 119
Hpy188I TCNGA 3 cut(s) 210, 257, 280
Hpy188III TCNNGA 1 cut(s) 298
HpyCH4III ACNGT 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 269
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 98
LpnPI CCDG 1 cut(s) 303
LweI GCATC 1 cut(s) 63
MaeI CTAG 2 cut(s) 38, 167
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 3 cut(s) 86, 89, 245
MluCI AATT 3 cut(s) 114, 227, 355
MmeI TCCRAC 1 cut(s) 280
MnlI CCTC 8 cut(s) 15, 76, 103, 150, 184, 196, 235, 294
MseI TTAA 1 cut(s) 284
NdeII GATC 1 cut(s) 3
SaqAI TTAA 1 cut(s) 284
Sau3AI GATC 1 cut(s) 3
SetI ASST 5 cut(s) 103, 136, 207, 305, 369
SfaNI GCATC 1 cut(s) 63
SgeI CNNG 8 cut(s) 28, 50, 179, 198, 212, 260, 302, 310
Sse9I AATT 3 cut(s) 114, 227, 355
SsiI CCGC 1 cut(s) 199
SspMI CTAG 2 cut(s) 38, 167
TaaI ACNGT 1 cut(s) 148
TasI AATT 3 cut(s) 114, 227, 355
Tru1I TTAA 1 cut(s) 284
Tru9I TTAA 1 cut(s) 284
XspI CTAG 2 cut(s) 38, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.