RchiOBHm_Chr7g0232531

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
N/A
Physical Location & Seq
Reverse (-)
56649405 .. 56649624
220 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20842

Sequence Viewer

Length: 165 bp
ATGGATCCAGAGTATCAGAGAACTGACCCAATTAGACCCAAATCGGATTTATACGCATTTGGGGTCATTATCCTCCAACTATTGACAGCACGGCATCCAAATAGGCTTTATATACATTGTGGAAAATGCAATTGCAAATGGTTCTTTTGCCGACTTTTTAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.55

Weight (kDa)

9.38

Isoelectric Point (pI)

33.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AlwI GGATC 1 cut(s) 12
BamHI GGATCC 1 cut(s) 4
BceAI ACGGC 1 cut(s) 107
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 1 cut(s) 103
BseGI GGATG 1 cut(s) 94
Bsp143I GATC 1 cut(s) 4
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 12
BssMI GATC 1 cut(s) 4
BstF5I GGATG 1 cut(s) 94
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BtsCI GGATG 1 cut(s) 94
CviJI RGCY 1 cut(s) 106
CviKI_1 RGCY 1 cut(s) 106
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
FaiI YATR 3 cut(s) 52, 111, 113
FokI GGATG 1 cut(s) 81
Hpy188I TCNGA 2 cut(s) 18, 46
Hpy188III TCNNGA 1 cut(s) 8
HpyCH4V TGCA 2 cut(s) 129, 135
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 21
LweI GCATC 1 cut(s) 103
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MfeI CAATTG 1 cut(s) 130
MflI RGATCY 1 cut(s) 4
MluCI AATT 2 cut(s) 30, 130
MmeI TCCRAC 1 cut(s) 100
MnlI CCTC 1 cut(s) 83
MunI CAATTG 1 cut(s) 130
NdeII GATC 1 cut(s) 4
NlaIV GGNNCC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 4
Sau3AI GATC 1 cut(s) 4
SfaNI GCATC 1 cut(s) 103
SgeI CNNG 2 cut(s) 20, 102
Sse9I AATT 2 cut(s) 30, 130
TasI AATT 2 cut(s) 30, 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.