RchiOBHm_Chr7g0232551

L-type lectin-domain containing receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
N/A
Physical Location & Seq
Reverse (-)
56654212 .. 56655059
848 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20844

Sequence Viewer

Length: 264 bp
ATGGTAGCCTCAACATGCATCCTGCTTGACAGAAGCTTCAACTCGATTGTTGTCCTATCCTGGAAGCAAAGGTTGTGTCTGCCTTTGCATATTTTCATGAAGACTGGGTGGAAGACACGAGATGTCAAAGCTTGCAACATAATGATTGATGCAGATTTTAGTGGCAAACTTGGGGATTGTGGTCTCACAGAAGTATATGAGCATAATATTATGACAAGAGCAGCTACCAATACCAGCCAGAACGATGGAGTATCTTGCCCCTGA

Protein Analysis

87

Amino Acids

9.68

Weight (kDa)

7.64

Isoelectric Point (pI)

46.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 40
AjnI CCWGG 1 cut(s) 59
AluBI AGCT 3 cut(s) 36, 131, 224
AluI AGCT 3 cut(s) 36, 131, 224
Alw26I GTCTC 1 cut(s) 188
ApeKI GCWGC 1 cut(s) 221
ArsI GACNNNNNNTTYG 2 cut(s) 61, 93
BauI CACGAG 1 cut(s) 117
BbsI GAAGAC 2 cut(s) 107, 119
BbvI GCAGC 1 cut(s) 233
BccI CCATC 1 cut(s) 239
BciT130I CCWGG 1 cut(s) 61
BcoDI GTCTC 1 cut(s) 188
BisI GCNGC 1 cut(s) 222
BlsI GCNGC 1 cut(s) 223
Bme1390I CCNGG 1 cut(s) 61
BmrFI CCNGG 1 cut(s) 61
BmrI ACTGGG 1 cut(s) 114
BmsI GCATC 2 cut(s) 27, 139
BmuI ACTGGG 1 cut(s) 114
BpiI GAAGAC 2 cut(s) 107, 119
BsaI GGTCTC 1 cut(s) 188
Bse1I ACTGG 1 cut(s) 109
BseBI CCWGG 1 cut(s) 61
BseGI GGATG 1 cut(s) 18
BseNI ACTGG 1 cut(s) 109
BseXI GCAGC 1 cut(s) 233
BsmAI GTCTC 1 cut(s) 188
Bso31I GGTCTC 1 cut(s) 188
BspHI TCATGA 1 cut(s) 96
BspTNI GGTCTC 1 cut(s) 188
BsrI ACTGG 1 cut(s) 109
BssSI CACGAG 1 cut(s) 117
Bst2BI CACGAG 1 cut(s) 117
Bst2UI CCWGG 1 cut(s) 61
BstC8I GCNNGC 1 cut(s) 133
BstF5I GGATG 1 cut(s) 18
BstMAI GTCTC 1 cut(s) 188
BstNI CCWGG 1 cut(s) 61
BstNSI RCATGY 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 59
BstV1I GCAGC 1 cut(s) 233
BstV2I GAAGAC 2 cut(s) 107, 119
BstXI CCANNNNNNTGG 1 cut(s) 245
BtsCI GGATG 1 cut(s) 18
Cac8I GCNNGC 1 cut(s) 133
CciI TCATGA 1 cut(s) 96
CviAII CATG 2 cut(s) 15, 97
CviJI RGCY 5 cut(s) 8, 36, 131, 224, 237
CviKI_1 RGCY 5 cut(s) 8, 36, 131, 224, 237
Eco31I GGTCTC 1 cut(s) 188
EcoRII CCWGG 1 cut(s) 59
EcoT22I ATGCAT 1 cut(s) 20
FaeI CATG 2 cut(s) 18, 100
FaiI YATR 8 cut(s) 16, 90, 98, 140, 196, 198, 204, 212
FatI CATG 2 cut(s) 14, 96
Fnu4HI GCNGC 1 cut(s) 222
FokI GGATG 1 cut(s) 5
Fsp4HI GCNGC 1 cut(s) 222
GluI GCNGC 1 cut(s) 222
Hin1II CATG 2 cut(s) 18, 100
HindIII AAGCTT 2 cut(s) 34, 129
Hpy188III TCNNGA 1 cut(s) 97
HpyCH4V TGCA 4 cut(s) 18, 88, 135, 152
Hsp92II CATG 2 cut(s) 18, 100
LpnPI CCDG 6 cut(s) 35, 46, 73, 90, 247, 251
Lsp1109I GCAGC 1 cut(s) 233
LweI GCATC 2 cut(s) 27, 139
MboII GAAGA 2 cut(s) 112, 124
MnlI CCTC 1 cut(s) 19
Mph1103I ATGCAT 1 cut(s) 20
MspR9I CCNGG 1 cut(s) 61
MvaI CCWGG 1 cut(s) 61
NlaIII CATG 2 cut(s) 18, 100
NsiI ATGCAT 1 cut(s) 20
NspI RCATGY 1 cut(s) 18
PagI TCATGA 1 cut(s) 96
PfoI TCCNGGA 1 cut(s) 59
PkrI GCNGC 1 cut(s) 223
Psp6I CCWGG 1 cut(s) 59
PspGI CCWGG 1 cut(s) 59
SatI GCNGC 1 cut(s) 222
ScrFI CCNGG 1 cut(s) 61
SetI ASST 4 cut(s) 38, 74, 133, 226
SfaNI GCATC 2 cut(s) 27, 139
SspI AATATT 1 cut(s) 208
StyD4I CCNGG 1 cut(s) 59
TaqI TCGA 1 cut(s) 44
TseI GCWGC 1 cut(s) 221
TspDTI ATGAA 2 cut(s) 85, 113
XceI RCATGY 1 cut(s) 18
Zsp2I ATGCAT 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.