RchiOBHm_Chr7g0239651
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
N/A
Physical Location & Seq
Reverse (-)
65355177 .. 65355907
731 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21479

Sequence Viewer

Length: 480 bp
ATGACAAACTTTACCAATCTCTATCTCGGTGTAAATGAACTTTCTGGAACTATTCCTAAATATATAGGGAACCTCAAATCTATTTTGGTTCTAGGATTGAGTGATAATCAACTCAGTGGTTCAATTCCAACAATACTAGGTGATCTGACAACCCTTACAAGTCTCTATCTCGGTGTGAACAAACTTTCTAGCACTATCCCTTCTGAACTAGGAAATTTGAAGTCTCTTGTGGAATTAGGCCTGGTAGACAACAATCTTTCGGGTTCAGTTCCTACTTCCTTTGGAAACTTGACCAACTTGGAAGTCTTAAACCTCTTAGGCAACCAACTTTGGATTCAAATTTGCTCACCACGAATACTTTGGTGGTTAAATTGGAGAAAAGAAGTTTTGGAGCTTAAAGTCAGACGCAGGATTGAAAAGGATGCTGGCCATTCTGATCTTCCAGAATTGTCTCTGTTTTGCGTCAACTTCAAAGATTAA

Protein Analysis

159

Amino Acids

17.6

Weight (kDa)

5.82

Isoelectric Point (pI)

23.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 8 - 107 3.8e-11 Leucine-rich repeat region
LRR_8 PF13855 51 - 110 1.8e-06 Leucine rich repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 246
AcoI YGGCCR 1 cut(s) 427
AcsI RAATTY 2 cut(s) 214, 339
AgsI TTSAA 5 cut(s) 123, 220, 338, 416, 472
AjnI CCWGG 1 cut(s) 240
AjuI GAANNNNNNNTTGG 2 cut(s) 318, 350
AluBI AGCT 1 cut(s) 394
AluI AGCT 1 cut(s) 394
Alw26I GTCTC 3 cut(s) 167, 228, 456
AoxI GGCC 2 cut(s) 238, 427
ApoI RAATTY 2 cut(s) 214, 339
AsuHPI GGTGA 2 cut(s) 152, 339
BalI TGGCCA 1 cut(s) 429
BciT130I CCWGG 1 cut(s) 242
BcoDI GTCTC 3 cut(s) 167, 228, 456
BfaI CTAG 4 cut(s) 92, 137, 189, 209
Bme1390I CCNGG 1 cut(s) 242
BmiI GGNNCC 1 cut(s) 71
BmrFI CCNGG 1 cut(s) 242
BmsI GCATC 1 cut(s) 412
BseBI CCWGG 1 cut(s) 242
BseGI GGATG 1 cut(s) 427
BseMII CTCAG 1 cut(s) 127
BshFI GGCC 2 cut(s) 240, 429
BsmAI GTCTC 3 cut(s) 167, 228, 456
BsnI GGCC 2 cut(s) 240, 429
Bsp143I GATC 2 cut(s) 142, 436
BspANI GGCC 2 cut(s) 240, 429
BspCNI CTCAG 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 71
BssMI GATC 2 cut(s) 142, 436
Bst2UI CCWGG 1 cut(s) 242
BstC8I GCNNGC 1 cut(s) 427
BstDEI CTNAG 2 cut(s) 113, 316
BstF5I GGATG 1 cut(s) 427
BstKTI GATC 2 cut(s) 145, 439
BstMAI GTCTC 3 cut(s) 167, 228, 456
BstMBI GATC 2 cut(s) 142, 436
BstNI CCWGG 1 cut(s) 242
BstSCI CCNGG 1 cut(s) 240
BsuRI GGCC 2 cut(s) 240, 429
BtsCI GGATG 1 cut(s) 427
BtsIMutI CAGTG 1 cut(s) 121
Cac8I GCNNGC 1 cut(s) 427
CseI GACGC 2 cut(s) 414, 451
CviJI RGCY 3 cut(s) 240, 394, 429
CviKI_1 RGCY 3 cut(s) 240, 394, 429
DdeI CTNAG 2 cut(s) 113, 316
DpnI GATC 2 cut(s) 144, 438
DpnII GATC 2 cut(s) 142, 436
EaeI YGGCCR 1 cut(s) 427
Eco147I AGGCCT 1 cut(s) 240
EcoRII CCWGG 1 cut(s) 240
FaiI YATR 2 cut(s) 63, 65
FblI GTMKAC 1 cut(s) 246
FokI GGATG 1 cut(s) 434
FspBI CTAG 4 cut(s) 92, 137, 189, 209
HaeIII GGCC 2 cut(s) 240, 429
HgaI GACGC 2 cut(s) 414, 451
HincII GTYRAC 1 cut(s) 466
HindII GTYRAC 1 cut(s) 466
HinfI GANTC 1 cut(s) 334
HphI GGTGA 2 cut(s) 152, 339
Hpy166II GTNNAC 3 cut(s) 178, 247, 466
Hpy188I TCNGA 4 cut(s) 147, 205, 404, 436
Hpy188III TCNNGA 2 cut(s) 45, 443
Hpy8I GTNNAC 3 cut(s) 178, 247, 466
HpyAV CCTTC 1 cut(s) 210
HpyF3I CTNAG 2 cut(s) 113, 316
Kzo9I GATC 2 cut(s) 142, 436
LmnI GCTCC 1 cut(s) 391
LpnPI CCDG 6 cut(s) 30, 227, 254, 394, 411, 456
LweI GCATC 1 cut(s) 412
MaeI CTAG 4 cut(s) 92, 137, 189, 209
MalI GATC 2 cut(s) 144, 438
MboI GATC 2 cut(s) 142, 436
MboII GAAGA 1 cut(s) 431
MlsI TGGCCA 1 cut(s) 429
MluCI AATT 6 cut(s) 123, 214, 233, 339, 370, 446
MluNI TGGCCA 1 cut(s) 429
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 2 cut(s) 83, 323
Mox20I TGGCCA 1 cut(s) 429
MscI TGGCCA 1 cut(s) 429
MseI TTAA 4 cut(s) 308, 368, 396, 478
Msp20I TGGCCA 1 cut(s) 429
MspR9I CCNGG 1 cut(s) 242
MvaI CCWGG 1 cut(s) 242
NdeII GATC 2 cut(s) 142, 436
NlaIV GGNNCC 1 cut(s) 71
PceI AGGCCT 1 cut(s) 240
PfeI GAWTC 1 cut(s) 334
Psp6I CCWGG 1 cut(s) 240
PspGI CCWGG 1 cut(s) 240
PspN4I GGNNCC 1 cut(s) 71
SaqAI TTAA 4 cut(s) 308, 368, 396, 478
Sau3AI GATC 2 cut(s) 142, 436
ScrFI CCNGG 1 cut(s) 242
SetI ASST 4 cut(s) 75, 142, 315, 396
SfaNI GCATC 1 cut(s) 412
Sse9I AATT 6 cut(s) 123, 214, 233, 339, 370, 446
SseBI AGGCCT 1 cut(s) 240
SspMI CTAG 4 cut(s) 92, 137, 189, 209
StuI AGGCCT 1 cut(s) 240
StyD4I CCNGG 1 cut(s) 240
TasI AATT 6 cut(s) 123, 214, 233, 339, 370, 446
TfiI GAWTC 1 cut(s) 334
Tru1I TTAA 4 cut(s) 308, 368, 396, 478
Tru9I TTAA 4 cut(s) 308, 368, 396, 478
TscAI CASTG 1 cut(s) 121
TspDTI ATGAA 1 cut(s) 51
TspRI CASTG 1 cut(s) 121
XapI RAATTY 2 cut(s) 214, 339
XcmI CCANNNNNNNNNTGG 1 cut(s) 357
XmiI GTMKAC 1 cut(s) 246
XspI CTAG 4 cut(s) 92, 137, 189, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.