RLG00000014355

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
N/A
Physical Location & Seq
Forward (+)
51933269 .. 51934534
1266 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000014355

Sequence Viewer

Length: 684 bp
ATGGATTTGTCATGGTGTGGTCTCACAAAAATTCCCAACTTATCTGGACTTCCAAACTTAGTGGACTTGATTCTTAAATGGTGTTTAAATTTAGTTGAAGTTCATCCTTCGGTTGGATTTCTTGATAAGCTGGTTAAGTTGGACCTGGAGGGATGCCAATTCCTTACTGTTCTCCCAGGAAGAATCAATTTGAAATCTTTGGAAACTCTTAGCCTGCGGTATTGCCATAGGCTTGAGAACTTTCCTGAAATCTTGGGAGAGATGAAGTCCTTAAAATGTCTTGATCTAGCGGAGACTGCCATCAAAGCATTGCCATCATCAATCCGATATCTCATTAATCTCGAAAGGCTAAACTTAAGAGCATGTGGACATCTTACAAATATACCATGCATCACATATGAGTTGCAACATCTACAGTGTCTTGATCTCCAGTATTGCCAAAAATTGGTTACATTTCCAATAATGCCACAACATGAAGATGTGTCTATGGAGCTATTGGTCCATGAAGTTGATGATGAGCACTCCAGCTTCAGTGATGAAGACTTTGAAGACGAGGAATTGATCCCAGAAGATGAAGACTTGAGAAATGCCTACTTGTCTCAAAATGATGACCATCATCACCAGAAAGCAATGAATCCTCGAAAGAGGAAGGTCAACTGGGTTGAACCAAATTCTTGTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

228

Amino Acids

26.22

Weight (kDa)

5.01

Isoelectric Point (pI)

37.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_13 PF23286 64 - 149 3.7e-09 Disease resistance protein RPS4B-like, leucine-rich repeats
LRR_14 PF23598 85 - 149 2.8e-07 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 445
AciI CCGC 2 cut(s) 217, 290
AclWI GGATC 1 cut(s) 556
AcsI RAATTY 3 cut(s) 30, 88, 670
AcuI CTGAAG 1 cut(s) 514
AfiI CCNNNNNNNGG 2 cut(s) 113, 445
AflII CTTAAG 1 cut(s) 355
AgsI TTSAA 4 cut(s) 98, 193, 548, 665
AjnI CCWGG 2 cut(s) 144, 175
AluBI AGCT 3 cut(s) 130, 493, 528
AluI AGCT 3 cut(s) 130, 493, 528
Alw21I GWGCWC 1 cut(s) 522
Alw26I GTCTC 3 cut(s) 26, 287, 603
AlwI GGATC 1 cut(s) 556
ApoI RAATTY 3 cut(s) 30, 88, 670
AseI ATTAAT 1 cut(s) 336
AspS9I GGNCC 2 cut(s) 142, 499
AsuHPI GGTGA 1 cut(s) 611
AvaII GGWCC 2 cut(s) 142, 499
BbsI GAAGAC 3 cut(s) 546, 555, 582
Bbv12I GWGCWC 1 cut(s) 522
BccI CCATC 3 cut(s) 308, 322, 621
BciT130I CCWGG 2 cut(s) 146, 177
BcoDI GTCTC 3 cut(s) 26, 287, 603
BfaI CTAG 1 cut(s) 287
BfmI CTRYAG 1 cut(s) 413
BfrI CTTAAG 1 cut(s) 355
Bme1390I CCNGG 2 cut(s) 146, 177
Bme18I GGWCC 2 cut(s) 142, 499
BmgT120I GGNCC 2 cut(s) 142, 499
BmrFI CCNGG 2 cut(s) 146, 177
BmrI ACTGGG 1 cut(s) 667
BmsI GCATC 2 cut(s) 143, 399
BmuI ACTGGG 1 cut(s) 667
BpiI GAAGAC 3 cut(s) 546, 555, 582
BpmI CTGGAG 3 cut(s) 167, 413, 508
BpuEI CTTGAG 2 cut(s) 254, 601
BsaBI GATNNNNATC 1 cut(s) 612
BsaI GGTCTC 1 cut(s) 26
BsaJI CCNNGG 1 cut(s) 175
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 445
Bse1I ACTGG 2 cut(s) 430, 662
Bse3DI GCAATG 2 cut(s) 308, 636
Bse8I GATNNNNATC 1 cut(s) 612
BseBI CCWGG 2 cut(s) 146, 177
BseDI CCNNGG 1 cut(s) 175
BseGI GGATG 2 cut(s) 103, 158
BseJI GATNNNNATC 1 cut(s) 612
BseLI CCNNNNNNNGG 2 cut(s) 113, 445
BseMI GCAATG 2 cut(s) 308, 636
BseNI ACTGG 2 cut(s) 430, 662
BsiHKAI GWGCWC 1 cut(s) 522
BslI CCNNNNNNNGG 2 cut(s) 113, 445
BsmAI GTCTC 3 cut(s) 26, 287, 603
Bso31I GGTCTC 1 cut(s) 26
Bsp1286I GDGCHC 1 cut(s) 522
Bsp143I GATC 3 cut(s) 283, 424, 561
BspACI CCGC 2 cut(s) 217, 290
BspPI GGATC 1 cut(s) 556
BspTI CTTAAG 1 cut(s) 355
BspTNI GGTCTC 1 cut(s) 26
BsrDI GCAATG 2 cut(s) 308, 636
BsrI ACTGG 2 cut(s) 430, 662
BssECI CCNNGG 1 cut(s) 175
BssMI GATC 3 cut(s) 283, 424, 561
Bst2UI CCWGG 2 cut(s) 146, 177
Bst4CI ACNGT 2 cut(s) 169, 417
BstAFI CTTAAG 1 cut(s) 355
BstC8I GCNNGC 1 cut(s) 215
BstDEI CTNAG 2 cut(s) 58, 209
BstF5I GGATG 2 cut(s) 103, 158
BstKTI GATC 3 cut(s) 286, 427, 564
BstMAI GTCTC 3 cut(s) 26, 287, 603
BstMBI GATC 3 cut(s) 283, 424, 561
BstMWI GCNNNNNNNGC 2 cut(s) 296, 305
BstNI CCWGG 2 cut(s) 146, 177
BstNSI RCATGY 1 cut(s) 366
BstSCI CCNGG 2 cut(s) 144, 175
BstSFI CTRYAG 1 cut(s) 413
BstV2I GAAGAC 3 cut(s) 546, 555, 582
BtsCI GGATG 2 cut(s) 103, 158
BtsIMutI CAGTG 2 cut(s) 422, 538
Cac8I GCNNGC 1 cut(s) 215
Cfr13I GGNCC 2 cut(s) 142, 499
CspCI CAANNNNNGTGG 2 cut(s) 42, 77
CviAII CATG 5 cut(s) 12, 363, 387, 473, 503
CviJI RGCY 6 cut(s) 130, 213, 232, 349, 493, 528
CviKI_1 RGCY 6 cut(s) 130, 213, 232, 349, 493, 528
DdeI CTNAG 2 cut(s) 58, 209
DpnI GATC 3 cut(s) 285, 426, 563
DpnII GATC 3 cut(s) 283, 424, 561
DraI TTTAAA 1 cut(s) 87
Eco31I GGTCTC 1 cut(s) 26
Eco32I GATATC 1 cut(s) 329
Eco47I GGWCC 2 cut(s) 142, 499
Eco57I CTGAAG 1 cut(s) 514
EcoRII CCWGG 2 cut(s) 144, 175
EcoRV GATATC 1 cut(s) 329
EcoT22I ATGCAT 1 cut(s) 392
FaeI CATG 5 cut(s) 15, 366, 390, 476, 506
FatI CATG 5 cut(s) 11, 362, 386, 472, 502
FauNDI CATATG 1 cut(s) 397
FokI GGATG 2 cut(s) 90, 165
FspBI CTAG 1 cut(s) 287
GsuI CTGGAG 3 cut(s) 167, 413, 508
Hin1II CATG 5 cut(s) 15, 366, 390, 476, 506
HincII GTYRAC 1 cut(s) 655
HindII GTYRAC 1 cut(s) 655
HinfI GANTC 3 cut(s) 70, 183, 634
HphI GGTGA 1 cut(s) 611
Hpy166II GTNNAC 3 cut(s) 64, 368, 655
Hpy188I TCNGA 1 cut(s) 326
Hpy188III TCNNGA 6 cut(s) 45, 122, 245, 281, 341, 422
Hpy8I GTNNAC 3 cut(s) 64, 368, 655
HpyAV CCTTC 2 cut(s) 117, 643
HpyCH4III ACNGT 2 cut(s) 169, 417
HpyCH4V TGCA 2 cut(s) 390, 406
HpyF10VI GCNNNNNNNGC 2 cut(s) 296, 305
HpyF3I CTNAG 2 cut(s) 58, 209
Hsp92II CATG 5 cut(s) 15, 366, 390, 476, 506
Kzo9I GATC 3 cut(s) 283, 424, 561
LmnI GCTCC 1 cut(s) 490
LweI GCATC 2 cut(s) 143, 399
MaeI CTAG 1 cut(s) 287
MaeIII GTNAC 1 cut(s) 448
MalI GATC 3 cut(s) 285, 426, 563
MboI GATC 3 cut(s) 283, 424, 561
MboII GAAGA 6 cut(s) 192, 488, 551, 560, 581, 587
MhlI GDGCHC 1 cut(s) 522
MluCI AATT 7 cut(s) 30, 88, 158, 187, 443, 557, 670
MmeI TCCRAC 2 cut(s) 94, 120
MnlI CCTC 4 cut(s) 142, 547, 639, 648
Mph1103I ATGCAT 1 cut(s) 392
MseI TTAA 6 cut(s) 75, 86, 135, 272, 336, 356
MslI CAYNNNNRTG 1 cut(s) 477
MspCI CTTAAG 1 cut(s) 355
MspR9I CCNGG 2 cut(s) 146, 177
MvaI CCWGG 2 cut(s) 146, 177
MwoI GCNNNNNNNGC 2 cut(s) 296, 305
NdeI CATATG 1 cut(s) 397
NdeII GATC 3 cut(s) 283, 424, 561
NlaIII CATG 5 cut(s) 15, 366, 390, 476, 506
NsiI ATGCAT 1 cut(s) 392
NspI RCATGY 1 cut(s) 366
PfeI GAWTC 3 cut(s) 70, 183, 634
PflMI CCANNNNNTGG 1 cut(s) 445
PshBI ATTAAT 1 cut(s) 336
Psp6I CCWGG 2 cut(s) 144, 175
PspGI CCWGG 2 cut(s) 144, 175
PspPI GGNCC 2 cut(s) 142, 499
RseI CAYNNNNRTG 1 cut(s) 477
SaqAI TTAA 6 cut(s) 75, 86, 135, 272, 336, 356
Sau3AI GATC 3 cut(s) 283, 424, 561
Sau96I GGNCC 2 cut(s) 142, 499
ScrFI CCNGG 2 cut(s) 146, 177
SduI GDGCHC 1 cut(s) 522
SetI ASST 5 cut(s) 132, 147, 495, 530, 654
SfaNI GCATC 2 cut(s) 143, 399
SfcI CTRYAG 1 cut(s) 413
SinI GGWCC 2 cut(s) 142, 499
SmiMI CAYNNNNRTG 1 cut(s) 477
SmlI CTYRAG 3 cut(s) 233, 355, 580
SmoI CTYRAG 3 cut(s) 233, 355, 580
Sse9I AATT 7 cut(s) 30, 88, 158, 187, 443, 557, 670
SsiI CCGC 2 cut(s) 217, 290
SspMI CTAG 1 cut(s) 287
StyD4I CCNGG 2 cut(s) 144, 175
TaaI ACNGT 2 cut(s) 169, 417
TaqI TCGA 2 cut(s) 342, 640
TasI AATT 7 cut(s) 30, 88, 158, 187, 443, 557, 670
TfiI GAWTC 3 cut(s) 70, 183, 634
Tru1I TTAA 6 cut(s) 75, 86, 135, 272, 336, 356
Tru9I TTAA 6 cut(s) 75, 86, 135, 272, 336, 356
TscAI CASTG 2 cut(s) 422, 538
TspDTI ATGAA 7 cut(s) 92, 278, 489, 519, 552, 588, 647
TspRI CASTG 2 cut(s) 422, 538
Van91I CCANNNNNTGG 1 cut(s) 445
Vha464I CTTAAG 1 cut(s) 355
VpaK11BI GGWCC 2 cut(s) 142, 499
VspI ATTAAT 1 cut(s) 336
XapI RAATTY 3 cut(s) 30, 88, 670
XceI RCATGY 1 cut(s) 366
XspI CTAG 1 cut(s) 287
Zsp2I ATGCAT 1 cut(s) 392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.