RLG00000019255
TCP Family

TCP-1/cpn60 chaperonin family

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
N/A
Physical Location & Seq
Reverse (-)
49037923 .. 49038424
502 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000019255

Sequence Viewer

Length: 408 bp
ATGCTGTACATTGAACACTGCGCAAATTCAAGGGCTGTAACCATATTTATCCACGGAGGTAACAAAATGATGATAGAGGAGACCAAGCGCAGTATCCACAATGCTTTATGTGTTGCTAGGAATCTTATTCACAACAATTCTATTGTCCACGGTGGTGGCTCAGTAGAGATATCTTGCCAGCATAGTGGCCTTCAACCTATTGAAACACTAAATGCAATGAAATCTCAGCAGATCAAGGAGAAAAATCCCCACTGTGGAATAGACTGGAACGATGTTGGCACTAATGATATGTGTGAGCAGAATGTCTTCGAGACTTTAATTGGAAAGCAGCAGCAAATCTTGCTCGCCACACAAGTTGTCAAGATGATACTTAAAATAGATGATGTTATCTCCCCCTCCGAGTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.07

Weight (kDa)

6.13

Isoelectric Point (pI)

59.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cpn60_TCP1 PF00118 1 - 60 2.3e-15 TCP-1/cpn60 chaperonin family
Cpn60_TCP1 PF00118 60 - 131 6.5e-13 TCP-1/cpn60 chaperonin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 22
AcsI RAATTY 1 cut(s) 25
AfaI GTAC 2 cut(s) 8, 404
AfiI CCNNNNNNNGG 1 cut(s) 254
AgsI TTSAA 4 cut(s) 14, 30, 194, 203
AleI CACNNNNGTG 1 cut(s) 153
Alw26I GTCTC 2 cut(s) 74, 305
AoxI GGCC 1 cut(s) 187
ApeKI GCWGC 2 cut(s) 328, 331
ApoI RAATTY 1 cut(s) 25
Asp700I GAANNNNTTC 1 cut(s) 305
AspLEI GCGC 2 cut(s) 23, 90
BbsI GAAGAC 1 cut(s) 298
BbvI GCAGC 2 cut(s) 340, 343
BciVI GTATCC 1 cut(s) 104
BcoDI GTCTC 2 cut(s) 74, 305
BfaI CTAG 1 cut(s) 117
BfuI GTATCC 1 cut(s) 104
BisI GCNGC 2 cut(s) 329, 332
BlsI GCNGC 2 cut(s) 330, 333
BmcAI AGTACT 1 cut(s) 404
BpiI GAAGAC 1 cut(s) 298
BsaI GGTCTC 1 cut(s) 74
BsaJI CCNNGG 2 cut(s) 52, 148
Bsc4I CCNNNNNNNGG 1 cut(s) 254
Bse1I ACTGG 1 cut(s) 269
Bse3DI GCAATG 1 cut(s) 222
BseDI CCNNGG 2 cut(s) 52, 148
BseLI CCNNNNNNNGG 1 cut(s) 254
BseMI GCAATG 1 cut(s) 222
BseMII CTCAG 2 cut(s) 174, 239
BseNI ACTGG 1 cut(s) 269
BseRI GAGGAG 1 cut(s) 92
BseXI GCAGC 2 cut(s) 340, 343
BshFI GGCC 1 cut(s) 189
BslI CCNNNNNNNGG 1 cut(s) 254
BsmAI GTCTC 2 cut(s) 74, 305
BsnI GGCC 1 cut(s) 189
Bso31I GGTCTC 1 cut(s) 74
Bsp1407I TGTACA 1 cut(s) 6
Bsp143I GATC 1 cut(s) 231
BspANI GGCC 1 cut(s) 189
BspCNI CTCAG 2 cut(s) 173, 238
BspTNI GGTCTC 1 cut(s) 74
BsrDI GCAATG 1 cut(s) 222
BsrGI TGTACA 1 cut(s) 6
BsrI ACTGG 1 cut(s) 269
BssECI CCNNGG 2 cut(s) 52, 148
BssMI GATC 1 cut(s) 231
Bst4CI ACNGT 2 cut(s) 152, 254
BstAPI GCANNNNNTGC 1 cut(s) 340
BstAUI TGTACA 1 cut(s) 6
BstC8I GCNNGC 2 cut(s) 179, 345
BstDEI CTNAG 2 cut(s) 160, 225
BstDSI CCRYGG 2 cut(s) 52, 148
BstHHI GCGC 2 cut(s) 23, 90
BstKTI GATC 1 cut(s) 234
BstMAI GTCTC 2 cut(s) 74, 305
BstMBI GATC 1 cut(s) 231
BstMWI GCNNNNNNNGC 1 cut(s) 340
BstV1I GCAGC 2 cut(s) 340, 343
BstV2I GAAGAC 1 cut(s) 298
BstXI CCANNNNNNTGG 2 cut(s) 155, 185
BsuI GTATCC 1 cut(s) 104
BsuRI GGCC 1 cut(s) 189
BtgI CCRYGG 2 cut(s) 52, 148
BtsI GCAGTG 1 cut(s) 16
BtsIMutI CAGTG 2 cut(s) 16, 250
Cac8I GCNNGC 2 cut(s) 179, 345
CfoI GCGC 2 cut(s) 23, 90
Csp6I GTAC 2 cut(s) 7, 403
CspCI CAANNNNNGTGG 2 cut(s) 337, 372
CviJI RGCY 3 cut(s) 35, 159, 189
CviKI_1 RGCY 3 cut(s) 35, 159, 189
CviQI GTAC 2 cut(s) 7, 403
DdeI CTNAG 2 cut(s) 160, 225
DpnI GATC 1 cut(s) 233
DpnII GATC 1 cut(s) 231
Eco31I GGTCTC 1 cut(s) 74
Eco32I GATATC 1 cut(s) 171
EcoRV GATATC 1 cut(s) 171
FaiI YATR 4 cut(s) 44, 109, 183, 290
Fnu4HI GCNGC 2 cut(s) 329, 332
Fsp4HI GCNGC 2 cut(s) 329, 332
FspBI CTAG 1 cut(s) 117
FspI TGCGCA 1 cut(s) 22
GlaI GCGC 2 cut(s) 22, 89
GluI GCNGC 2 cut(s) 329, 332
HaeIII GGCC 1 cut(s) 189
HhaI GCGC 2 cut(s) 23, 90
Hin6I GCGC 2 cut(s) 21, 88
HinP1I GCGC 2 cut(s) 21, 88
HinfI GANTC 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 400
Hpy188III TCNNGA 2 cut(s) 310, 361
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 200
HpyCH4III ACNGT 2 cut(s) 152, 254
HpyCH4V TGCA 1 cut(s) 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 340
HpyF3I CTNAG 2 cut(s) 160, 225
HspAI GCGC 2 cut(s) 21, 88
Kzo9I GATC 1 cut(s) 231
LpnPI CCDG 2 cut(s) 191, 250
Lsp1109I GCAGC 2 cut(s) 340, 343
MaeI CTAG 1 cut(s) 117
MaeIII GTNAC 2 cut(s) 37, 59
MalI GATC 1 cut(s) 233
MboI GATC 1 cut(s) 231
MboII GAAGA 1 cut(s) 298
MluCI AATT 3 cut(s) 25, 136, 318
MnlI CCTC 3 cut(s) 50, 70, 406
MroXI GAANNNNTTC 1 cut(s) 305
MseI TTAA 2 cut(s) 317, 372
MslI CAYNNNNRTG 1 cut(s) 153
MwoI GCNNNNNNNGC 1 cut(s) 340
NdeII GATC 1 cut(s) 231
NsbI TGCGCA 1 cut(s) 22
OliI CACNNNNGTG 1 cut(s) 153
PdmI GAANNNNTTC 1 cut(s) 305
PfeI GAWTC 1 cut(s) 121
PkrI GCNGC 2 cut(s) 330, 333
RsaI GTAC 2 cut(s) 8, 404
RsaNI GTAC 2 cut(s) 7, 403
RseI CAYNNNNRTG 1 cut(s) 153
SaqAI TTAA 2 cut(s) 317, 372
SatI GCNGC 2 cut(s) 329, 332
Sau3AI GATC 1 cut(s) 231
ScaI AGTACT 1 cut(s) 404
SetI ASST 2 cut(s) 61, 199
SmiMI CAYNNNNRTG 1 cut(s) 153
Sse9I AATT 3 cut(s) 25, 136, 318
SspMI CTAG 1 cut(s) 117
TaaI ACNGT 2 cut(s) 152, 254
TaqI TCGA 1 cut(s) 309
TasI AATT 3 cut(s) 25, 136, 318
TatI WGTACW 2 cut(s) 6, 402
TfiI GAWTC 1 cut(s) 121
Tru1I TTAA 2 cut(s) 317, 372
Tru9I TTAA 2 cut(s) 317, 372
TscAI CASTG 2 cut(s) 23, 257
TseI GCWGC 2 cut(s) 328, 331
TspDTI ATGAA 1 cut(s) 233
TspGWI ACGGA 1 cut(s) 69
TspRI CASTG 2 cut(s) 23, 257
XapI RAATTY 1 cut(s) 25
XmnI GAANNNNTTC 1 cut(s) 305
XspI CTAG 1 cut(s) 117
ZrmI AGTACT 1 cut(s) 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.