RLG00000023575

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
N/A
Physical Location & Seq
Forward (+)
25398030 .. 25399076
1047 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000023575

Sequence Viewer

Length: 396 bp
ATGCAAAGATTGAGGAAATTGTATCTACTGGAACTACCGGAGTTGAGGAGCATTGGGATAAAATTGCTAGAAGACCTGGAAATTCTACATGTTCAGTCTTGTGATAAGTTACAAACTTTGTTCAAGTGTGATTCACAATCTAGTTGTGTAATGCAAAGATTGAGGAAATTGTATCTACAGGAACTACCAGAGTTGAGGAGCATTGGGATAAAATTGCCAGCTCAACTGACTTCTGTCGTCATCAAATGCCCCAAGTTGCTGAAGCTCCAGTTGGATGCGACCGACAGGTCTCCAAGTAATTCTCAATCTTGGGTCAAGAATGAATGCAGAACTGTTGTCTTTGGAACTTTATGCTCTGTAATGCAATTCAAACATAAAAGAGTTTGCAAGCTTTAA
Functional Annotation

Protein Analysis

132

Amino Acids

15.17

Weight (kDa)

9.51

Isoelectric Point (pI)

68.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_RPS2 PF23247 21 - 77 5.1e-06 Plant disease resistance protein RPS2-like, leucine-rich repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 286
AcsI RAATTY 1 cut(s) 81
AcuI CTGAAG 1 cut(s) 281
AflIII ACRYGT 1 cut(s) 88
AgsI TTSAA 2 cut(s) 124, 370
AjnI CCWGG 1 cut(s) 75
AjuI GAANNNNNNNTTGG 2 cut(s) 254, 286
AluBI AGCT 3 cut(s) 221, 265, 391
AluI AGCT 3 cut(s) 221, 265, 391
Alw26I GTCTC 1 cut(s) 294
ApoI RAATTY 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 78
BciT130I CCWGG 1 cut(s) 77
BcoDI GTCTC 1 cut(s) 294
BfaI CTAG 2 cut(s) 68, 141
BfmI CTRYAG 1 cut(s) 176
Bme1390I CCNGG 1 cut(s) 77
BmrFI CCNGG 1 cut(s) 77
BmsI GCATC 1 cut(s) 265
BoxI GACNNNNGTC 1 cut(s) 233
BpiI GAAGAC 1 cut(s) 78
BpmI CTGGAG 1 cut(s) 251
BsaI GGTCTC 1 cut(s) 294
BsaWI WCCGGW 1 cut(s) 37
Bse1I ACTGG 2 cut(s) 33, 268
BseBI CCWGG 1 cut(s) 77
BseGI GGATG 1 cut(s) 280
BseNI ACTGG 2 cut(s) 33, 268
BseRI GAGGAG 2 cut(s) 61, 211
Bsh1285I CGRYCG 1 cut(s) 282
BsiEI CGRYCG 1 cut(s) 282
BsiSI CCGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 294
BsmI GAATGC 1 cut(s) 329
Bso31I GGTCTC 1 cut(s) 294
BspTNI GGTCTC 1 cut(s) 294
BsrI ACTGG 2 cut(s) 33, 268
Bst2UI CCWGG 1 cut(s) 77
Bst4CI ACNGT 1 cut(s) 334
BstC8I GCNNGC 2 cut(s) 219, 389
BstF5I GGATG 1 cut(s) 280
BstMAI GTCTC 1 cut(s) 294
BstMCI CGRYCG 1 cut(s) 282
BstNI CCWGG 1 cut(s) 77
BstNSI RCATGY 1 cut(s) 92
BstPAI GACNNNNGTC 1 cut(s) 233
BstSCI CCNGG 1 cut(s) 75
BstSFI CTRYAG 1 cut(s) 176
BstV2I GAAGAC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 280
Cac8I GCNNGC 2 cut(s) 219, 389
CviAII CATG 1 cut(s) 89
CviJI RGCY 3 cut(s) 221, 265, 391
CviKI_1 RGCY 3 cut(s) 221, 265, 391
DrdI GACNNNNNNGTC 1 cut(s) 286
DseDI GACNNNNNNGTC 1 cut(s) 286
Eco31I GGTCTC 1 cut(s) 294
Eco57I CTGAAG 1 cut(s) 281
EcoRII CCWGG 1 cut(s) 75
FaeI CATG 1 cut(s) 92
FaiI YATR 3 cut(s) 90, 352, 375
FatI CATG 1 cut(s) 88
FokI GGATG 1 cut(s) 287
FspBI CTAG 2 cut(s) 68, 141
GsuI CTGGAG 1 cut(s) 251
HapII CCGG 1 cut(s) 38
Hin1II CATG 1 cut(s) 92
HindIII AAGCTT 1 cut(s) 389
HinfI GANTC 1 cut(s) 131
HpaII CCGG 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 316
HpyCH4III ACNGT 1 cut(s) 334
HpyCH4V TGCA 5 cut(s) 4, 154, 327, 364, 387
Hsp92II CATG 1 cut(s) 92
LmnI GCTCC 3 cut(s) 48, 198, 270
LpnPI CCDG 9 cut(s) 14, 51, 62, 89, 164, 201, 231, 271, 281
LweI GCATC 1 cut(s) 265
MaeI CTAG 2 cut(s) 68, 141
MaeIII GTNAC 1 cut(s) 108
MboII GAAGA 1 cut(s) 83
MluCI AATT 7 cut(s) 17, 62, 81, 167, 212, 298, 365
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 4 cut(s) 6, 39, 156, 189
MseI TTAA 1 cut(s) 394
MspI CCGG 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 77
Mva1269I GAATGC 1 cut(s) 329
MvaI CCWGG 1 cut(s) 77
NlaIII CATG 1 cut(s) 92
NspI RCATGY 1 cut(s) 92
PciI ACATGT 1 cut(s) 88
PctI GAATGC 1 cut(s) 329
PfeI GAWTC 1 cut(s) 131
PscI ACATGT 1 cut(s) 88
PshAI GACNNNNGTC 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 75
PspGI CCWGG 1 cut(s) 75
SaqAI TTAA 1 cut(s) 394
ScrFI CCNGG 1 cut(s) 77
SetI ASST 5 cut(s) 78, 223, 267, 290, 393
SfaNI GCATC 1 cut(s) 265
SfcI CTRYAG 1 cut(s) 176
Sse9I AATT 7 cut(s) 17, 62, 81, 167, 212, 298, 365
SspMI CTAG 2 cut(s) 68, 141
StyD4I CCNGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 334
TaqII GACCGA 1 cut(s) 296
TasI AATT 7 cut(s) 17, 62, 81, 167, 212, 298, 365
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 394
Tru9I TTAA 1 cut(s) 394
TspDTI ATGAA 1 cut(s) 336
XapI RAATTY 1 cut(s) 81
XceI RCATGY 1 cut(s) 92
XspI CTAG 2 cut(s) 68, 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.