RLG00000024704

protein serine/threonine kinase activity

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
N/A
Physical Location & Seq
Reverse (-)
38402802 .. 38403702
901 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000024704

Sequence Viewer

Length: 369 bp
ATGACAAATGGATTCAAGAAGAAGTTGGGTGAAGGAGGTTTTGGAAGTGTTTTCAGTGGAAAGCTTCCGAGTAATGGACTTCCGGTAGCCATAAAAGTCCTCACGGATTCTGAAGGAAATGGAGATGATTTTGTTAATGAAGTGGAACGATTGATAGGATTCACCAATTTCGGGATACTAGTTCTTGAAGTTATTGGAGCTAGGAAAGAATCTGCTGTTACATCTAGCGACAATGAGTGGTACCCGGTGAATCACCCTTCCATGAAAGCAGTTGTTAGAATGCTGGAAGGACCCTCTGAAATCTTGATCATGCCACCCAATCCGTTTGCTTCCACAACTCAGATGGAAACAGCAACCCCATCAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.03

Weight (kDa)

4.91

Isoelectric Point (pI)

26.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 240
AccB1I GGYRCC 1 cut(s) 240
AcuI CTGAAG 1 cut(s) 132
AfaI GTAC 1 cut(s) 242
AfiI CCNNNNNNNGG 2 cut(s) 74, 171
AgsI TTSAA 2 cut(s) 16, 188
AhlI ACTAGT 1 cut(s) 178
AjuI GAANNNNNNNTTGG 2 cut(s) 24, 56
AluBI AGCT 2 cut(s) 64, 200
AluI AGCT 2 cut(s) 64, 200
Asp718I GGTACC 1 cut(s) 240
AspS9I GGNCC 1 cut(s) 290
AsuC2I CCSGG 1 cut(s) 245
AsuHPI GGTGA 4 cut(s) 41, 154, 245, 259
AvaII GGWCC 1 cut(s) 290
BanI GGYRCC 1 cut(s) 240
BccI CCATC 2 cut(s) 337, 367
BciVI GTATCC 1 cut(s) 168
BclI TGATCA 1 cut(s) 306
BcnI CCSGG 1 cut(s) 245
BcuI ACTAGT 1 cut(s) 178
BfaI CTAG 3 cut(s) 179, 201, 225
BfuI GTATCC 1 cut(s) 168
Bme1390I CCNGG 1 cut(s) 245
Bme18I GGWCC 1 cut(s) 290
BmgT120I GGNCC 1 cut(s) 290
BmiI GGNNCC 2 cut(s) 242, 292
BmrFI CCNGG 1 cut(s) 245
BpuMI CCSGG 1 cut(s) 245
BsaWI WCCGGW 1 cut(s) 82
Bsc4I CCNNNNNNNGG 2 cut(s) 74, 171
BseLI CCNNNNNNNGG 2 cut(s) 74, 171
BseMII CTCAG 1 cut(s) 353
BshNI GGYRCC 1 cut(s) 240
BsiSI CCGG 2 cut(s) 83, 245
BslI CCNNNNNNNGG 2 cut(s) 74, 171
BsmI GAATGC 1 cut(s) 285
Bsp143I GATC 1 cut(s) 306
BspCNI CTCAG 1 cut(s) 352
BspLI GGNNCC 2 cut(s) 242, 292
BspT107I GGYRCC 1 cut(s) 240
BssMI GATC 1 cut(s) 306
BstDEI CTNAG 1 cut(s) 339
BstKTI GATC 1 cut(s) 309
BstMBI GATC 1 cut(s) 306
BstSCI CCNGG 1 cut(s) 243
BsuI GTATCC 1 cut(s) 168
BtsIMutI CAGTG 1 cut(s) 61
Cfr13I GGNCC 1 cut(s) 290
Csp6I GTAC 1 cut(s) 241
CviAII CATG 2 cut(s) 262, 310
CviJI RGCY 3 cut(s) 64, 89, 200
CviKI_1 RGCY 3 cut(s) 64, 89, 200
CviQI GTAC 1 cut(s) 241
DdeI CTNAG 1 cut(s) 339
DpnI GATC 1 cut(s) 308
DpnII GATC 1 cut(s) 306
Eco47I GGWCC 1 cut(s) 290
Eco57I CTGAAG 1 cut(s) 132
EcoO109I RGGNCCY 1 cut(s) 290
FaeI CATG 2 cut(s) 265, 313
FaiI YATR 3 cut(s) 92, 263, 311
FatI CATG 2 cut(s) 261, 309
FbaI TGATCA 1 cut(s) 306
FspBI CTAG 3 cut(s) 179, 201, 225
HapII CCGG 2 cut(s) 83, 245
Hin1II CATG 2 cut(s) 265, 313
HindIII AAGCTT 1 cut(s) 62
HinfI GANTC 5 cut(s) 12, 107, 159, 209, 250
HpaII CCGG 2 cut(s) 83, 245
HphI GGTGA 4 cut(s) 41, 154, 245, 259
Hpy188I TCNGA 4 cut(s) 69, 112, 298, 342
Hpy188III TCNNGA 4 cut(s) 16, 172, 185, 304
HpyAV CCTTC 4 cut(s) 26, 107, 267, 281
HpyF3I CTNAG 1 cut(s) 339
Hsp92II CATG 2 cut(s) 265, 313
KpnI GGTACC 1 cut(s) 244
Ksp22I TGATCA 1 cut(s) 306
Kzo9I GATC 1 cut(s) 306
LmnI GCTCC 1 cut(s) 197
LpnPI CCDG 3 cut(s) 96, 258, 269
MaeI CTAG 3 cut(s) 179, 201, 225
MaeIII GTNAC 1 cut(s) 217
MalI GATC 1 cut(s) 308
MboI GATC 1 cut(s) 306
MboII GAAGA 1 cut(s) 31
MluCI AATT 1 cut(s) 166
MnlI CCTC 3 cut(s) 29, 110, 304
MseI TTAA 2 cut(s) 135, 367
MspI CCGG 2 cut(s) 83, 245
MspR9I CCNGG 1 cut(s) 245
Mva1269I GAATGC 1 cut(s) 285
NciI CCSGG 1 cut(s) 245
NdeII GATC 1 cut(s) 306
NlaIII CATG 2 cut(s) 265, 313
NlaIV GGNNCC 2 cut(s) 242, 292
PctI GAATGC 1 cut(s) 285
PfeI GAWTC 5 cut(s) 12, 107, 159, 209, 250
PpuMI RGGWCCY 1 cut(s) 290
Psp5II RGGWCCY 1 cut(s) 290
PspN4I GGNNCC 2 cut(s) 242, 292
PspPI GGNCC 1 cut(s) 290
PspPPI RGGWCCY 1 cut(s) 290
RsaI GTAC 1 cut(s) 242
RsaNI GTAC 1 cut(s) 241
SaqAI TTAA 2 cut(s) 135, 367
Sau3AI GATC 1 cut(s) 306
Sau96I GGNCC 1 cut(s) 290
ScrFI CCNGG 1 cut(s) 245
SetI ASST 3 cut(s) 40, 66, 202
SinI GGWCC 1 cut(s) 290
SpeI ACTAGT 1 cut(s) 178
Sse9I AATT 1 cut(s) 166
SspMI CTAG 3 cut(s) 179, 201, 225
StyD4I CCNGG 1 cut(s) 243
TasI AATT 1 cut(s) 166
TfiI GAWTC 5 cut(s) 12, 107, 159, 209, 250
Tru1I TTAA 2 cut(s) 135, 367
Tru9I TTAA 2 cut(s) 135, 367
TscAI CASTG 1 cut(s) 61
TspDTI ATGAA 2 cut(s) 153, 278
TspGWI ACGGA 2 cut(s) 119, 312
TspRI CASTG 1 cut(s) 61
VpaK11BI GGWCC 1 cut(s) 290
XcmI CCANNNNNNNNNTGG 1 cut(s) 340
XspI CTAG 3 cut(s) 179, 201, 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.