RLG00000024774

Leucine-rich repeat

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
N/A
Physical Location & Seq
Forward (+)
39054500 .. 39054937
438 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000024774

Sequence Viewer

Length: 438 bp
ATGGCTTACTCCAACTGTCAATCAATCAAGTCTAGCACTCTGAAGGATTTTGCAGATAGCTCAGTACGGTTAAGTATCGACCAGTTTGATCGTGGCCTTAGACCTGATCATAGGGCGACCAGAAAGAGTACTTATGGCGGATATGCTCACATGCCATCATCTTCATCAACGCACGGTCAAGCAAATCCATATGTACTATCATTGAAGAAGTCCAGGGGCAGGCATGGACACCTTCCCCCAAGTGGGACTAAGCCTACAACAAGCCATACTCGACATCACTATTTTGGTATTGGCAATAAGCTTATGAACCTCAAACAGGACATTTCAATGCGCAGGAGTCGGAATGAGGGAATATGGAAGCTAATTGAGATTATTTTGATGTATGGTTTTTATACTTTGATGTGGGAGCTTCAGAGATACCCTCCCGGGACCACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_4 LRR_6 LRR_8

Protein Analysis

146

Amino Acids

16.55

Weight (kDa)

10.14

Isoelectric Point (pI)

53.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 332
AciI CCGC 1 cut(s) 138
AcuI CTGAAG 2 cut(s) 62, 395
AfaI GTAC 3 cut(s) 66, 130, 195
AfiI CCNNNNNNNGG 4 cut(s) 219, 242, 243, 316
AgsI TTSAA 2 cut(s) 205, 327
AjnI CCWGG 1 cut(s) 212
AluBI AGCT 4 cut(s) 60, 301, 361, 409
AluI AGCT 4 cut(s) 60, 301, 361, 409
Ama87I CYCGRG 1 cut(s) 425
AoxI GGCC 1 cut(s) 94
AspLEI GCGC 1 cut(s) 333
AspS9I GGNCC 1 cut(s) 429
AsuC2I CCSGG 2 cut(s) 426, 427
AvaI CYCGRG 1 cut(s) 425
AvaII GGWCC 1 cut(s) 429
BccI CCATC 1 cut(s) 163
BciT130I CCWGG 1 cut(s) 214
BclI TGATCA 1 cut(s) 106
BcnI CCSGG 2 cut(s) 426, 427
BfaI CTAG 1 cut(s) 33
BmcAI AGTACT 1 cut(s) 130
Bme1390I CCNGG 3 cut(s) 214, 426, 427
Bme18I GGWCC 1 cut(s) 429
BmeT110I CYCGRG 1 cut(s) 425
BmgT120I GGNCC 1 cut(s) 429
BmiI GGNNCC 1 cut(s) 430
BmrFI CCNGG 3 cut(s) 214, 426, 427
BplI GAGNNNNNCTC 2 cut(s) 406, 438
BpuMI CCSGG 2 cut(s) 426, 427
BsaJI CCNNGG 2 cut(s) 213, 425
Bsc4I CCNNNNNNNGG 4 cut(s) 219, 242, 243, 316
Bse1I ACTGG 1 cut(s) 82
BseBI CCWGG 1 cut(s) 214
BseDI CCNNGG 2 cut(s) 213, 425
BseLI CCNNNNNNNGG 4 cut(s) 219, 242, 243, 316
BseMII CTCAG 1 cut(s) 75
BseNI ACTGG 1 cut(s) 82
BshFI GGCC 1 cut(s) 96
BsiHKCI CYCGRG 1 cut(s) 425
BsiSI CCGG 1 cut(s) 426
BslFI GGGAC 1 cut(s) 259
BslI CCNNNNNNNGG 4 cut(s) 219, 242, 243, 316
BsmFI GGGAC 1 cut(s) 259
BsnI GGCC 1 cut(s) 96
BsoBI CYCGRG 1 cut(s) 425
Bsp143I GATC 2 cut(s) 88, 106
BspACI CCGC 1 cut(s) 138
BspANI GGCC 1 cut(s) 96
BspCNI CTCAG 1 cut(s) 74
BspLI GGNNCC 1 cut(s) 430
BsrI ACTGG 1 cut(s) 82
BssECI CCNNGG 2 cut(s) 213, 425
BssMI GATC 2 cut(s) 88, 106
Bst2UI CCWGG 1 cut(s) 214
Bst4CI ACNGT 3 cut(s) 17, 69, 176
BstC8I GCNNGC 1 cut(s) 221
BstDEI CTNAG 3 cut(s) 61, 98, 249
BstENI CCTNNNNNAGG 1 cut(s) 314
BstHHI GCGC 1 cut(s) 333
BstKTI GATC 2 cut(s) 91, 109
BstMBI GATC 2 cut(s) 88, 106
BstNI CCWGG 1 cut(s) 214
BstNSI RCATGY 1 cut(s) 154
BstSCI CCNGG 3 cut(s) 212, 424, 425
BsuRI GGCC 1 cut(s) 96
Cac8I GCNNGC 1 cut(s) 221
CfoI GCGC 1 cut(s) 333
Cfr13I GGNCC 1 cut(s) 429
Cfr9I CCCGGG 1 cut(s) 425
Csp6I GTAC 3 cut(s) 65, 129, 194
CviAII CATG 2 cut(s) 151, 224
CviJI RGCY 8 cut(s) 5, 60, 96, 253, 264, 301, 361, 409
CviKI_1 RGCY 8 cut(s) 5, 60, 96, 253, 264, 301, 361, 409
CviQI GTAC 3 cut(s) 65, 129, 194
DdeI CTNAG 3 cut(s) 61, 98, 249
DpnI GATC 2 cut(s) 90, 108
DpnII GATC 2 cut(s) 88, 106
EciI GGCGGA 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 429
Eco57I CTGAAG 2 cut(s) 62, 395
Eco88I CYCGRG 1 cut(s) 425
EcoNI CCTNNNNNAGG 1 cut(s) 314
EcoRII CCWGG 1 cut(s) 212
FaeI CATG 2 cut(s) 154, 227
FaqI GGGAC 1 cut(s) 259
FatI CATG 2 cut(s) 150, 223
FauNDI CATATG 1 cut(s) 190
FbaI TGATCA 1 cut(s) 106
FspBI CTAG 1 cut(s) 33
FspI TGCGCA 1 cut(s) 332
GlaI GCGC 1 cut(s) 332
HaeIII GGCC 1 cut(s) 96
HapII CCGG 1 cut(s) 426
HhaI GCGC 1 cut(s) 333
Hin1II CATG 2 cut(s) 154, 227
Hin6I GCGC 1 cut(s) 331
HinP1I GCGC 1 cut(s) 331
HindIII AAGCTT 1 cut(s) 299
HinfI GANTC 1 cut(s) 337
HpaII CCGG 1 cut(s) 426
Hpy188I TCNGA 3 cut(s) 42, 342, 414
HpyAV CCTTC 2 cut(s) 37, 242
HpyCH4III ACNGT 3 cut(s) 17, 69, 176
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 3 cut(s) 61, 98, 249
Hsp92II CATG 2 cut(s) 154, 227
HspAI GCGC 1 cut(s) 331
Ksp22I TGATCA 1 cut(s) 106
Kzo9I GATC 2 cut(s) 88, 106
LmnI GCTCC 1 cut(s) 406
LpnPI CCDG 8 cut(s) 95, 117, 133, 199, 205, 226, 302, 319
MaeI CTAG 1 cut(s) 33
MalI GATC 2 cut(s) 90, 108
MboI GATC 2 cut(s) 88, 106
MboII GAAGA 2 cut(s) 153, 217
MluCI AATT 1 cut(s) 363
MlyI GAGTC 1 cut(s) 346
MmeI TCCRAC 2 cut(s) 36, 320
MnlI CCTC 3 cut(s) 320, 340, 432
MseI TTAA 1 cut(s) 71
MslI CAYNNNNRTG 1 cut(s) 326
MspI CCGG 1 cut(s) 426
MspR9I CCNGG 3 cut(s) 214, 426, 427
MvaI CCWGG 1 cut(s) 214
NciI CCSGG 2 cut(s) 426, 427
NdeI CATATG 1 cut(s) 190
NdeII GATC 2 cut(s) 88, 106
NlaIII CATG 2 cut(s) 154, 227
NlaIV GGNNCC 1 cut(s) 430
NsbI TGCGCA 1 cut(s) 332
NspI RCATGY 1 cut(s) 154
PleI GAGTC 1 cut(s) 345
PpsI GAGTC 1 cut(s) 345
Psp6I CCWGG 1 cut(s) 212
PspGI CCWGG 1 cut(s) 212
PspN4I GGNNCC 1 cut(s) 430
PspPI GGNCC 1 cut(s) 429
RsaI GTAC 3 cut(s) 66, 130, 195
RsaNI GTAC 3 cut(s) 65, 129, 194
RseI CAYNNNNRTG 1 cut(s) 326
SaqAI TTAA 1 cut(s) 71
Sau3AI GATC 2 cut(s) 88, 106
Sau96I GGNCC 1 cut(s) 429
ScaI AGTACT 1 cut(s) 130
SchI GAGTC 1 cut(s) 346
ScrFI CCNGG 3 cut(s) 214, 426, 427
SetI ASST 8 cut(s) 62, 106, 234, 303, 312, 363, 411, 437
SinI GGWCC 1 cut(s) 429
SmaI CCCGGG 1 cut(s) 427
SmiMI CAYNNNNRTG 1 cut(s) 326
Sse9I AATT 1 cut(s) 363
SsiI CCGC 1 cut(s) 138
SspMI CTAG 1 cut(s) 33
StyD4I CCNGG 3 cut(s) 212, 424, 425
TaaI ACNGT 3 cut(s) 17, 69, 176
TaqI TCGA 2 cut(s) 78, 271
TasI AATT 1 cut(s) 363
TatI WGTACW 2 cut(s) 128, 193
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TspDTI ATGAA 2 cut(s) 153, 320
TspMI CCCGGG 1 cut(s) 425
VpaK11BI GGWCC 1 cut(s) 429
XagI CCTNNNNNAGG 1 cut(s) 314
XceI RCATGY 1 cut(s) 154
XcmI CCANNNNNNNNNTGG 1 cut(s) 89
XmaI CCCGGG 1 cut(s) 425
XspI CTAG 1 cut(s) 33
ZrmI AGTACT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.