RLG00000029534

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
N/A
Physical Location & Seq
Forward (+)
40024940 .. 40025350
411 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029534

Sequence Viewer

Length: 411 bp
ATGACTCGTGGATTTAACTCATTTAAGGACAAACTGGATGAAGGAGGTTATGGCTCTGTATTTAAAAGAAAGTTGCGTAGTGGCCGTTTTGGAGCAATTAAATTGTTGGGCAAGCCCAGAGCAAACGGACAAGAATTTGTCAGTGAGATAGCTACAATTGGGAGGATTCATCATGTTAATGTGGGGCAACTTGTTGGTTATTGTGTTGAGGGATCAAAGCGCACTCTAGTATATGATTTCATGCCGAATGGGTCTTTGGAAAGACAAATCTATTCTAAAGAAGCAAGTGTTCCCTTGGGTATTGAGAAAATGTATCAGATTTGCCTTGGGGTGGCTAAAGGGATTGAGTATCTGCATCAAGACTGTGACATGCAAATTTTACATTTTGAAGCCTCACAACATTCTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

137

Amino Acids

15.22

Weight (kDa)

9.01

Isoelectric Point (pI)

33.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 8 - 120 3.2e-16 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 9 - 128 2.1e-13 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 220
AcoI YGGCCR 1 cut(s) 82
AcsI RAATTY 2 cut(s) 134, 375
AfiI CCNNNNNNNGG 1 cut(s) 331
AgsI TTSAA 1 cut(s) 389
AjuI GAANNNNNNNTTGG 2 cut(s) 239, 271
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
AlwI GGATC 1 cut(s) 220
AoxI GGCC 1 cut(s) 82
ApoI RAATTY 2 cut(s) 134, 375
AspLEI GCGC 1 cut(s) 222
BauI CACGAG 1 cut(s) 6
BceAI ACGGC 1 cut(s) 69
BfaI CTAG 1 cut(s) 227
BmsI GCATC 1 cut(s) 364
BsaJI CCNNGG 2 cut(s) 294, 325
Bsc4I CCNNNNNNNGG 1 cut(s) 331
Bse1I ACTGG 1 cut(s) 39
BseDI CCNNGG 2 cut(s) 294, 325
BseGI GGATG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 331
BseNI ACTGG 1 cut(s) 39
BshFI GGCC 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 331
BsnI GGCC 1 cut(s) 84
Bsp143I GATC 1 cut(s) 212
BspANI GGCC 1 cut(s) 84
BspPI GGATC 1 cut(s) 220
BsrI ACTGG 1 cut(s) 39
BssECI CCNNGG 2 cut(s) 294, 325
BssMI GATC 1 cut(s) 212
BssSI CACGAG 1 cut(s) 6
BssT1I CCWWGG 2 cut(s) 294, 325
Bst2BI CACGAG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 365
BstC8I GCNNGC 1 cut(s) 113
BstF5I GGATG 1 cut(s) 43
BstHHI GCGC 1 cut(s) 222
BstKTI GATC 1 cut(s) 215
BstMBI GATC 1 cut(s) 212
BstNSI RCATGY 1 cut(s) 373
BsuRI GGCC 1 cut(s) 84
BtsCI GGATG 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 113
CfoI GCGC 1 cut(s) 222
CviAII CATG 3 cut(s) 173, 241, 370
CviJI RGCY 6 cut(s) 54, 84, 115, 152, 335, 392
CviKI_1 RGCY 6 cut(s) 54, 84, 115, 152, 335, 392
DpnI GATC 1 cut(s) 214
DpnII GATC 1 cut(s) 212
DraI TTTAAA 1 cut(s) 64
EaeI YGGCCR 1 cut(s) 82
Eco130I CCWWGG 2 cut(s) 294, 325
EcoT14I CCWWGG 2 cut(s) 294, 325
ErhI CCWWGG 2 cut(s) 294, 325
FaeI CATG 3 cut(s) 176, 244, 373
FaiI YATR 6 cut(s) 51, 174, 232, 234, 242, 371
FatI CATG 3 cut(s) 172, 240, 369
FokI GGATG 1 cut(s) 50
FspBI CTAG 1 cut(s) 227
GlaI GCGC 1 cut(s) 221
HaeIII GGCC 1 cut(s) 84
HhaI GCGC 1 cut(s) 222
Hin1II CATG 3 cut(s) 176, 244, 373
Hin6I GCGC 1 cut(s) 220
HinP1I GCGC 1 cut(s) 220
HinfI GANTC 2 cut(s) 4, 166
Hpy188I TCNGA 1 cut(s) 318
Hpy188III TCNNGA 2 cut(s) 359, 408
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 365
HpyCH4V TGCA 2 cut(s) 355, 373
Hsp92II CATG 3 cut(s) 176, 244, 373
HspAI GCGC 1 cut(s) 220
Kzo9I GATC 1 cut(s) 212
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 2 cut(s) 20, 130
LweI GCATC 1 cut(s) 364
MaeI CTAG 1 cut(s) 227
MaeIII GTNAC 1 cut(s) 365
MalI GATC 1 cut(s) 214
MboI GATC 1 cut(s) 212
MboII GAAGA 1 cut(s) 396
MfeI CAATTG 1 cut(s) 156
MluCI AATT 5 cut(s) 96, 101, 134, 156, 375
MnlI CCTC 4 cut(s) 38, 156, 202, 403
MseI TTAA 5 cut(s) 15, 24, 63, 99, 177
MslI CAYNNNNRTG 1 cut(s) 177
MunI CAATTG 1 cut(s) 156
NdeII GATC 1 cut(s) 212
NlaIII CATG 3 cut(s) 176, 244, 373
NmuCI GTSAC 1 cut(s) 365
NspI RCATGY 1 cut(s) 373
PfeI GAWTC 1 cut(s) 166
RseI CAYNNNNRTG 1 cut(s) 177
SaqAI TTAA 5 cut(s) 15, 24, 63, 99, 177
Sau3AI GATC 1 cut(s) 212
SetI ASST 2 cut(s) 49, 154
SfaNI GCATC 1 cut(s) 364
SmiMI CAYNNNNRTG 1 cut(s) 177
Sse9I AATT 5 cut(s) 96, 101, 134, 156, 375
SspMI CTAG 1 cut(s) 227
StyI CCWWGG 2 cut(s) 294, 325
TaaI ACNGT 1 cut(s) 365
TasI AATT 5 cut(s) 96, 101, 134, 156, 375
TfiI GAWTC 1 cut(s) 166
Tru1I TTAA 5 cut(s) 15, 24, 63, 99, 177
Tru9I TTAA 5 cut(s) 15, 24, 63, 99, 177
TscAI CASTG 1 cut(s) 148
TseFI GTSAC 1 cut(s) 365
Tsp45I GTSAC 1 cut(s) 365
TspDTI ATGAA 3 cut(s) 54, 158, 229
TspGWI ACGGA 1 cut(s) 141
TspRI CASTG 1 cut(s) 148
XapI RAATTY 2 cut(s) 134, 375
XceI RCATGY 1 cut(s) 373
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.