RLG00000030061

Protein kinase domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
N/A
Physical Location & Seq
Forward (+)
54230679 .. 54231619
941 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030061

Sequence Viewer

Length: 591 bp
ATGGAAAAAACGAGCTCCCAAGATGACTTCAATAACAGTGTCTTCAATAAGAGTGCCAGTTCCGAAATCAATGCGGCTGTTGTTGCTTCTGTTATTTCAGTTTCTACTGTGGTGTTGATCATTGCTGTTACAGCCATTACATGTGCCATTACTAACTGCGTGAAAAAGTCTAGAAGTTCTATTTCAATTTCTGCCAAGATAATGAGTAGTAACAATACCGACAACAATTCCAACAACAAAGTAGCAGTGGACTTGAGACGTGATCAATTTCCTGTAGCTTTTGATTCCCTGGCTGAGTTTCCAACAATGAAAGGGTTCCTAAGCAACATGGCAAGAGAGAAGCCTATAACTTACTCAGCAAAGCAAATTGTAGAATTCACACATAACTATAGCTGCTCCAACATTTTAGGTTCAGGTGGTTTTGGAGAAGTATATAAAGGGCTTCTCGAAAATGGAGTACAAGTGGCTGTCAAGGTCCTTACCAACAACAATAGGGCTAAGATAGTTGAAGAGCAGTTTATGGTAGAAGCTGGAACCTTGGGAAGAACTTACTGTGTCAATAGAACGCAACGTATTGGATTCGTAACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

197

Amino Acids

21.25

Weight (kDa)

8.91

Isoelectric Point (pI)

32.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 133 - 194 6.6e-06 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 74
AcsI RAATTY 1 cut(s) 374
AfaI GTAC 1 cut(s) 459
AflIII ACRYGT 1 cut(s) 140
AgsI TTSAA 4 cut(s) 31, 46, 186, 509
AjiI CACGTC 1 cut(s) 260
AjnI CCWGG 1 cut(s) 288
AluBI AGCT 4 cut(s) 15, 278, 393, 530
AluI AGCT 4 cut(s) 15, 278, 393, 530
Alw21I GWGCWC 1 cut(s) 17
Alw26I GTCTC 1 cut(s) 250
ApeKI GCWGC 1 cut(s) 393
ApoI RAATTY 1 cut(s) 374
Asp700I GAANNNNTTC 1 cut(s) 314
AspS9I GGNCC 1 cut(s) 475
AvaII GGWCC 1 cut(s) 475
BanII GRGCYC 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 34
Bbv12I GWGCWC 1 cut(s) 17
BbvI GCAGC 1 cut(s) 380
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BciT130I CCWGG 1 cut(s) 290
BclI TGATCA 2 cut(s) 117, 262
BcoDI GTCTC 1 cut(s) 250
BfaI CTAG 1 cut(s) 171
BfmI CTRYAG 2 cut(s) 273, 388
BisI GCNGC 2 cut(s) 75, 394
BlsI GCNGC 2 cut(s) 76, 395
Bme1390I CCNGG 1 cut(s) 290
Bme18I GGWCC 1 cut(s) 475
BmgBI CACGTC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 475
BmiI GGNNCC 2 cut(s) 317, 535
BmrFI CCNGG 1 cut(s) 290
BpiI GAAGAC 1 cut(s) 34
Bpu10I CCTNAGC 1 cut(s) 320
BpuEI CTTGAG 1 cut(s) 274
BsaJI CCNNGG 2 cut(s) 288, 537
BsaXI ACNNNNNCTCC 2 cut(s) 447, 477
Bse1I ACTGG 1 cut(s) 57
Bse3DI GCAATG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 290
BseDI CCNNGG 2 cut(s) 288, 537
BseMI GCAATG 1 cut(s) 120
BseMII CTCAG 2 cut(s) 285, 369
BseNI ACTGG 1 cut(s) 57
BseXI GCAGC 1 cut(s) 380
BsiHKAI GWGCWC 1 cut(s) 17
BsmAI GTCTC 1 cut(s) 250
BsmBI CGTCTC 1 cut(s) 250
Bsp1286I GDGCHC 1 cut(s) 17
Bsp143I GATC 2 cut(s) 117, 262
BspACI CCGC 1 cut(s) 74
BspCNI CTCAG 2 cut(s) 286, 368
BspLI GGNNCC 2 cut(s) 317, 535
BspQI GCTCTTC 1 cut(s) 504
BsrDI GCAATG 1 cut(s) 120
BsrI ACTGG 1 cut(s) 57
BssECI CCNNGG 2 cut(s) 288, 537
BssMI GATC 2 cut(s) 117, 262
BssT1I CCWWGG 1 cut(s) 537
Bst2UI CCWGG 1 cut(s) 290
Bst4CI ACNGT 3 cut(s) 38, 109, 554
Bst6I CTCTTC 1 cut(s) 504
BstDEI CTNAG 5 cut(s) 294, 320, 355, 498, 588
BstKTI GATC 2 cut(s) 120, 265
BstMAI GTCTC 1 cut(s) 250
BstMBI GATC 2 cut(s) 117, 262
BstMWI GCNNNNNNNGC 2 cut(s) 83, 131
BstNI CCWGG 1 cut(s) 290
BstNSI RCATGY 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 288
BstSFI CTRYAG 2 cut(s) 273, 388
BstV1I GCAGC 1 cut(s) 380
BstV2I GAAGAC 1 cut(s) 34
BtrI CACGTC 1 cut(s) 260
BtsI GCAGTG 1 cut(s) 252
BtsIMutI CAGTG 2 cut(s) 43, 252
Cfr13I GGNCC 1 cut(s) 475
Csp6I GTAC 1 cut(s) 458
CviAII CATG 2 cut(s) 141, 328
CviQI GTAC 1 cut(s) 458
DdeI CTNAG 5 cut(s) 294, 320, 355, 498, 588
DpnI GATC 2 cut(s) 119, 264
DpnII GATC 2 cut(s) 117, 262
Eam1104I CTCTTC 1 cut(s) 504
EarI CTCTTC 1 cut(s) 504
Ecl136II GAGCTC 1 cut(s) 15
Eco130I CCWWGG 1 cut(s) 537
Eco24I GRGCYC 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 475
Eco53kI GAGCTC 1 cut(s) 15
EcoICRI GAGCTC 1 cut(s) 15
EcoO109I RGGNCCY 1 cut(s) 475
EcoRI GAATTC 1 cut(s) 374
EcoRII CCWGG 1 cut(s) 288
EcoT14I CCWWGG 1 cut(s) 537
EcoT38I GRGCYC 1 cut(s) 17
ErhI CCWWGG 1 cut(s) 537
Esp3I CGTCTC 1 cut(s) 250
FaeI CATG 2 cut(s) 144, 331
FaiI YATR 8 cut(s) 142, 329, 347, 384, 390, 433, 435, 521
FatI CATG 2 cut(s) 140, 327
FbaI TGATCA 2 cut(s) 117, 262
Fnu4HI GCNGC 2 cut(s) 75, 394
FriOI GRGCYC 1 cut(s) 17
Fsp4HI GCNGC 2 cut(s) 75, 394
FspBI CTAG 1 cut(s) 171
GluI GCNGC 2 cut(s) 75, 394
Hin1II CATG 2 cut(s) 144, 331
HinfI GANTC 2 cut(s) 284, 579
Hpy166II GTNNAC 1 cut(s) 250
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 2 cut(s) 171, 446
Hpy8I GTNNAC 1 cut(s) 250
HpyCH4III ACNGT 3 cut(s) 38, 109, 554
HpyCH4IV ACGT 2 cut(s) 259, 571
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 131
HpyF3I CTNAG 5 cut(s) 294, 320, 355, 498, 588
HpySE526I ACGT 2 cut(s) 259, 571
Hsp92II CATG 2 cut(s) 144, 331
Ksp22I TGATCA 2 cut(s) 117, 262
Kzo9I GATC 2 cut(s) 117, 262
LguI GCTCTTC 1 cut(s) 504
LmnI GCTCC 2 cut(s) 20, 401
LpnPI CCDG 6 cut(s) 70, 275, 285, 302, 399, 516
Lsp1109I GCAGC 1 cut(s) 380
MaeI CTAG 1 cut(s) 171
MaeII ACGT 2 cut(s) 259, 571
MaeIII GTNAC 3 cut(s) 127, 209, 583
MalI GATC 2 cut(s) 119, 264
MboI GATC 2 cut(s) 117, 262
MboII GAAGA 3 cut(s) 34, 521, 555
MhlI GDGCHC 1 cut(s) 17
MluCI AATT 5 cut(s) 186, 226, 266, 366, 374
MmeI TCCRAC 3 cut(s) 255, 326, 423
MroXI GAANNNNTTC 1 cut(s) 314
MspR9I CCNGG 1 cut(s) 290
MvaI CCWGG 1 cut(s) 290
MwoI GCNNNNNNNGC 2 cut(s) 83, 131
NdeII GATC 2 cut(s) 117, 262
NlaIII CATG 2 cut(s) 144, 331
NlaIV GGNNCC 2 cut(s) 317, 535
NspI RCATGY 1 cut(s) 144
PciI ACATGT 1 cut(s) 140
PciSI GCTCTTC 1 cut(s) 504
PdmI GAANNNNTTC 1 cut(s) 314
PfeI GAWTC 2 cut(s) 284, 579
PkrI GCNGC 2 cut(s) 76, 395
PpuMI RGGWCCY 1 cut(s) 475
PscI ACATGT 1 cut(s) 140
Psp124BI GAGCTC 1 cut(s) 17
Psp5II RGGWCCY 1 cut(s) 475
Psp6I CCWGG 1 cut(s) 288
PspGI CCWGG 1 cut(s) 288
PspN4I GGNNCC 2 cut(s) 317, 535
PspPI GGNCC 1 cut(s) 475
PspPPI RGGWCCY 1 cut(s) 475
RsaI GTAC 1 cut(s) 459
RsaNI GTAC 1 cut(s) 458
SacI GAGCTC 1 cut(s) 17
SapI GCTCTTC 1 cut(s) 504
SatI GCNGC 2 cut(s) 75, 394
Sau3AI GATC 2 cut(s) 117, 262
Sau96I GGNCC 1 cut(s) 475
ScrFI CCNGG 1 cut(s) 290
SduI GDGCHC 1 cut(s) 17
SfcI CTRYAG 2 cut(s) 273, 388
SinI GGWCC 1 cut(s) 475
SmlI CTYRAG 1 cut(s) 253
SmoI CTYRAG 1 cut(s) 253
Sse9I AATT 5 cut(s) 186, 226, 266, 366, 374
SsiI CCGC 1 cut(s) 74
SspMI CTAG 1 cut(s) 171
SstI GAGCTC 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 288
StyI CCWWGG 1 cut(s) 537
TaaI ACNGT 3 cut(s) 38, 109, 554
TaiI ACGT 2 cut(s) 262, 574
TaqI TCGA 1 cut(s) 447
TasI AATT 5 cut(s) 186, 226, 266, 366, 374
TatI WGTACW 1 cut(s) 457
TauI GCSGC 1 cut(s) 77
TfiI GAWTC 2 cut(s) 284, 579
TscAI CASTG 2 cut(s) 43, 252
TseI GCWGC 1 cut(s) 393
TspDTI ATGAA 1 cut(s) 323
TspRI CASTG 2 cut(s) 43, 252
VpaK11BI GGWCC 1 cut(s) 475
XapI RAATTY 1 cut(s) 374
XbaI TCTAGA 1 cut(s) 170
XceI RCATGY 1 cut(s) 144
XmnI GAANNNNTTC 1 cut(s) 314
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.