RLG00000036816

RESISTANCE protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
N/A
Physical Location & Seq
Reverse (-)
85092662 .. 85095109
2448 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000036816

Sequence Viewer

Length: 402 bp
ATGAGCTCCCATATAACCTCAGCATCTCCTTCTTCATCACCCGAATCATCATCAAGCTCCTCGGTGGTGGAAGTATGCAACAAGGCATTGACTACTGAAATTGAGCCTATAATGTCAAATTCCATTGAAGATTTTGAAGCAGTAGAAGCAACAAGACAAGCTGTCGTCGGACTTAAGTTGCTTAGTTTCAAAGTCTCTCCCTTCCATTCTTTGCTGAAAGGTCTAAGTTTGGACGAAACTTTAACTAAACATGAATCGTTGGAGGAAGACGAAGAGAAGGTGAAGCAGTGGTGGAGAGTAGCTTTGGAAAAAGTAGCTGGTCTCTCTGGGTGGGATTCAAGAATTACAAGTAATGCGCGTAATCTAGCTGGAACTAAAGGTCATCACATTTACTTTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

14.65

Weight (kDa)

5.5

Isoelectric Point (pI)

71.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 358
AcsI RAATTY 1 cut(s) 118
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 4 cut(s) 128, 137, 190, 339
AhdI GACNNNNNGTC 1 cut(s) 161
AluBI AGCT 6 cut(s) 6, 57, 161, 302, 317, 368
AluI AGCT 6 cut(s) 6, 57, 161, 302, 317, 368
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 2 cut(s) 199, 326
ApoI RAATTY 1 cut(s) 118
AspLEI GCGC 1 cut(s) 358
AsuHPI GGTGA 2 cut(s) 30, 292
BanII GRGCYC 1 cut(s) 8
BbsI GAAGAC 1 cut(s) 273
Bbv12I GWGCWC 1 cut(s) 8
BbvCI CCTCAGC 1 cut(s) 19
BcoDI GTCTC 2 cut(s) 199, 326
BfaI CTAG 1 cut(s) 365
BfrI CTTAAG 1 cut(s) 173
BmeRI GACNNNNNGTC 1 cut(s) 161
BmsI GCATC 1 cut(s) 32
BpiI GAAGAC 1 cut(s) 273
Bpu10I CCTNAGC 1 cut(s) 19
BsaI GGTCTC 1 cut(s) 326
BsaJI CCNNGG 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 60
BseMII CTCAG 1 cut(s) 33
BseRI GAGGAG 1 cut(s) 49
Bsh1236I CGCG 1 cut(s) 358
BsiHKAI GWGCWC 1 cut(s) 8
BsmAI GTCTC 2 cut(s) 199, 326
Bso31I GGTCTC 1 cut(s) 326
Bsp1286I GDGCHC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 32
BspFNI CGCG 1 cut(s) 358
BspTI CTTAAG 1 cut(s) 173
BspTNI GGTCTC 1 cut(s) 326
BssECI CCNNGG 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 267
BstAFI CTTAAG 1 cut(s) 173
BstDEI CTNAG 3 cut(s) 19, 182, 224
BstFNI CGCG 1 cut(s) 358
BstHHI GCGC 1 cut(s) 358
BstMAI GTCTC 2 cut(s) 199, 326
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstUI CGCG 1 cut(s) 358
BstV2I GAAGAC 1 cut(s) 273
BtsI GCAGTG 1 cut(s) 293
BtsIMutI CAGTG 1 cut(s) 293
CfoI GCGC 1 cut(s) 358
CviAII CATG 1 cut(s) 251
CviJI RGCY 7 cut(s) 6, 57, 106, 161, 302, 317, 368
CviKI_1 RGCY 7 cut(s) 6, 57, 106, 161, 302, 317, 368
DdeI CTNAG 3 cut(s) 19, 182, 224
DriI GACNNNNNGTC 1 cut(s) 161
Eam1104I CTCTTC 1 cut(s) 267
Eam1105I GACNNNNNGTC 1 cut(s) 161
EarI CTCTTC 1 cut(s) 267
Ecl136II GAGCTC 1 cut(s) 6
Eco24I GRGCYC 1 cut(s) 8
Eco31I GGTCTC 1 cut(s) 326
Eco53kI GAGCTC 1 cut(s) 6
EcoICRI GAGCTC 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 8
FaeI CATG 1 cut(s) 254
FaiI YATR 5 cut(s) 12, 14, 76, 110, 252
FatI CATG 1 cut(s) 250
FriOI GRGCYC 1 cut(s) 8
FspBI CTAG 1 cut(s) 365
GlaI GCGC 1 cut(s) 357
HhaI GCGC 1 cut(s) 358
Hin1II CATG 1 cut(s) 254
Hin6I GCGC 1 cut(s) 356
HinP1I GCGC 1 cut(s) 356
HinfI GANTC 3 cut(s) 44, 254, 335
HphI GGTGA 2 cut(s) 30, 292
Hpy188I TCNGA 1 cut(s) 170
Hpy188III TCNNGA 1 cut(s) 339
Hpy99I CGWCG 1 cut(s) 170
HpyAV CCTTC 3 cut(s) 39, 211, 271
HpyCH4V TGCA 1 cut(s) 78
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 3 cut(s) 19, 182, 224
Hsp92II CATG 1 cut(s) 254
HspAI GCGC 1 cut(s) 356
LmnI GCTCC 2 cut(s) 11, 62
LpnPI CCDG 3 cut(s) 303, 312, 354
LweI GCATC 1 cut(s) 32
MaeI CTAG 1 cut(s) 365
MboII GAAGA 4 cut(s) 24, 140, 278, 284
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 3 cut(s) 99, 118, 342
MmeI TCCRAC 2 cut(s) 148, 240
MnlI CCTC 3 cut(s) 28, 70, 256
MseI TTAA 2 cut(s) 174, 242
MspCI CTTAAG 1 cut(s) 173
MvnI CGCG 1 cut(s) 358
MwoI GCNNNNNNNGC 1 cut(s) 146
NlaIII CATG 1 cut(s) 254
PfeI GAWTC 3 cut(s) 44, 254, 335
Psp124BI GAGCTC 1 cut(s) 8
SacI GAGCTC 1 cut(s) 8
SaqAI TTAA 2 cut(s) 174, 242
SduI GDGCHC 1 cut(s) 8
SfaNI GCATC 1 cut(s) 32
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 3 cut(s) 99, 118, 342
SspMI CTAG 1 cut(s) 365
SstI GAGCTC 1 cut(s) 8
TasI AATT 3 cut(s) 99, 118, 342
TfiI GAWTC 3 cut(s) 44, 254, 335
Tru1I TTAA 2 cut(s) 174, 242
Tru9I TTAA 2 cut(s) 174, 242
TscAI CASTG 1 cut(s) 293
TspDTI ATGAA 2 cut(s) 24, 267
TspRI CASTG 1 cut(s) 293
Vha464I CTTAAG 1 cut(s) 173
XapI RAATTY 1 cut(s) 118
XspI CTAG 1 cut(s) 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.