Rmu_co7982726.1_g000001

mitogen-activated protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7982726.1
N/A
Physical Location & Seq
Reverse (-)
53 .. 403
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7982726.1_g000001.1.cds

Sequence Viewer

Length: 351 bp
ctgccccctcaggctgttcctccgtcttattgttaccggaaacccagtggtggaagtcaagaaaggtctgcagtggaagtgaatagagacttttcctcgcagtccaagcaagctgcacagtgtggcatggcaacaaaagtagcaccggatgtagcaatcaacattgacacaaacccattttttatgacacgggtgggagtcaacaaggtggaacatgatgaccgaattgctattgacacaaacttcttgcagtcaaaggttccatatggtgggattggtactgctgctgccactgcagctgcccaccgcaaggttggaactgttcagtttggcatgtcaaggatgtactag

Protein Analysis

116

Amino Acids

12.48

Weight (kDa)

9.3

Isoelectric Point (pI)

44.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 269
AciI CCGC 1 cut(s) 307
AdeI CACNNNGTG 1 cut(s) 122
AfaI GTAC 2 cut(s) 280, 347
AfiI CCNNNNNNNGG 3 cut(s) 50, 269, 310
AluBI AGCT 2 cut(s) 113, 299
AluI AGCT 2 cut(s) 113, 299
Alw26I GTCTC 1 cut(s) 81
ApeKI GCWGC 5 cut(s) 113, 284, 287, 296, 299
AxyI CCTNAGG 1 cut(s) 9
BbvI GCAGC 5 cut(s) 100, 271, 274, 286, 308
BcoDI GTCTC 1 cut(s) 81
BfaI CTAG 1 cut(s) 349
BfmI CTRYAG 2 cut(s) 69, 294
BisI GCNGC 5 cut(s) 114, 285, 288, 297, 300
BlsI GCNGC 5 cut(s) 115, 286, 289, 298, 301
BmiI GGNNCC 1 cut(s) 261
BmrI ACTGGG 1 cut(s) 39
BmuI ACTGGG 1 cut(s) 39
BsaWI WCCGGW 2 cut(s) 36, 145
Bsc4I CCNNNNNNNGG 3 cut(s) 50, 269, 310
Bse1I ACTGG 1 cut(s) 45
Bse21I CCTNAGG 1 cut(s) 9
BseGI GGATG 2 cut(s) 154, 348
BseLI CCNNNNNNNGG 3 cut(s) 50, 269, 310
BseMII CTCAG 1 cut(s) 23
BseNI ACTGG 1 cut(s) 45
BseXI GCAGC 5 cut(s) 100, 271, 274, 286, 308
BsgI GTGCAG 1 cut(s) 99
BsiSI CCGG 2 cut(s) 37, 146
BslI CCNNNNNNNGG 3 cut(s) 50, 269, 310
BsmAI GTCTC 1 cut(s) 81
BspACI CCGC 1 cut(s) 307
BspCNI CTCAG 1 cut(s) 22
BspLI GGNNCC 1 cut(s) 261
BspMAI CTGCAG 2 cut(s) 73, 298
BsrI ACTGG 1 cut(s) 45
Bst4CI ACNGT 2 cut(s) 120, 322
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 9
BstF5I GGATG 2 cut(s) 154, 348
BstMAI GTCTC 1 cut(s) 81
BstMWI GCNNNNNNNGC 3 cut(s) 106, 293, 296
BstNSI RCATGY 1 cut(s) 337
BstSFI CTRYAG 2 cut(s) 69, 294
BstV1I GCAGC 5 cut(s) 100, 271, 274, 286, 308
Bsu36I CCTNAGG 1 cut(s) 9
BtsCI GGATG 2 cut(s) 154, 348
BtsI GCAGTG 2 cut(s) 78, 291
BtsIMutI CAGTG 4 cut(s) 52, 78, 125, 291
Cac8I GCNNGC 1 cut(s) 111
Csp6I GTAC 2 cut(s) 279, 346
CviAII CATG 3 cut(s) 127, 215, 334
CviJI RGCY 3 cut(s) 14, 113, 299
CviKI_1 RGCY 3 cut(s) 14, 113, 299
CviQI GTAC 2 cut(s) 279, 346
DdeI CTNAG 1 cut(s) 9
DraIII CACNNNGTG 1 cut(s) 122
Eco81I CCTNAGG 1 cut(s) 9
FaeI CATG 3 cut(s) 130, 218, 337
FaiI YATR 6 cut(s) 128, 185, 216, 265, 267, 335
FatI CATG 3 cut(s) 126, 214, 333
FauNDI CATATG 1 cut(s) 265
Fnu4HI GCNGC 5 cut(s) 114, 285, 288, 297, 300
FokI GGATG 1 cut(s) 161
Fsp4HI GCNGC 5 cut(s) 114, 285, 288, 297, 300
FspBI CTAG 1 cut(s) 349
GluI GCNGC 5 cut(s) 114, 285, 288, 297, 300
HapII CCGG 2 cut(s) 37, 146
Hin1II CATG 3 cut(s) 130, 218, 337
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 1 cut(s) 198
HpaII CCGG 2 cut(s) 37, 146
Hpy166II GTNNAC 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 1 cut(s) 202
HpyCH4III ACNGT 2 cut(s) 120, 322
HpyCH4V TGCA 4 cut(s) 71, 116, 250, 296
HpyF10VI GCNNNNNNNGC 3 cut(s) 106, 293, 296
HpyF3I CTNAG 1 cut(s) 9
Hsp92II CATG 3 cut(s) 130, 218, 337
LpnPI CCDG 3 cut(s) 50, 58, 159
Lsp1109I GCAGC 5 cut(s) 100, 271, 274, 286, 308
MaeI CTAG 1 cut(s) 349
MaeIII GTNAC 1 cut(s) 32
MluCI AATT 1 cut(s) 225
MlyI GAGTC 1 cut(s) 207
MmeI TCCRAC 1 cut(s) 295
MnlI CCTC 3 cut(s) 18, 30, 106
MspA1I CMGCKG 1 cut(s) 299
MspI CCGG 2 cut(s) 37, 146
MwoI GCNNNNNNNGC 3 cut(s) 106, 293, 296
NdeI CATATG 1 cut(s) 265
NlaIII CATG 3 cut(s) 130, 218, 337
NlaIV GGNNCC 1 cut(s) 261
NspI RCATGY 1 cut(s) 337
PflMI CCANNNNNTGG 1 cut(s) 269
PkrI GCNGC 5 cut(s) 115, 286, 289, 298, 301
PleI GAGTC 1 cut(s) 206
PpsI GAGTC 1 cut(s) 206
PspN4I GGNNCC 1 cut(s) 261
PstI CTGCAG 2 cut(s) 73, 298
PvuII CAGCTG 1 cut(s) 299
RsaI GTAC 2 cut(s) 280, 347
RsaNI GTAC 2 cut(s) 279, 346
SatI GCNGC 5 cut(s) 114, 285, 288, 297, 300
SchI GAGTC 1 cut(s) 207
SetI ASST 6 cut(s) 68, 115, 210, 261, 301, 315
SfcI CTRYAG 2 cut(s) 69, 294
Sse9I AATT 1 cut(s) 225
SsiI CCGC 1 cut(s) 307
SspMI CTAG 1 cut(s) 349
TaaI ACNGT 2 cut(s) 120, 322
TaqII GACCGA 1 cut(s) 237
TasI AATT 1 cut(s) 225
TatI WGTACW 1 cut(s) 345
TscAI CASTG 4 cut(s) 52, 78, 125, 298
TseI GCWGC 5 cut(s) 113, 284, 287, 296, 299
TspGWI ACGGA 1 cut(s) 12
TspRI CASTG 4 cut(s) 52, 78, 125, 298
Van91I CCANNNNNTGG 1 cut(s) 269
XceI RCATGY 1 cut(s) 337
XcmI CCANNNNNNNNNTGG 1 cut(s) 311
XspI CTAG 1 cut(s) 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.