Rmu_co8022614.1_g000001

anion transporter 4

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8022614.1
N/A
Physical Location & Seq
Reverse (-)
2 .. 518
517 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8022614.1_g000001.1.cds

Sequence Viewer

Length: 347 bp
atgctatctccgattctcatgtcacaaggtggtgtatttggaccatttgtgatttttggtttatctggatttctttgggttttggtatggttatctgcaacatcaagtactcctgaccgcagtcctcagatatcaaaatatgaattggattacatacagagcgagaggcagaaatcctttctgggggaaaataaacctaagacaaccaaagtgatccctcctttcaggcgcttgctttctaaaccgcccacctgggccttaatagttgcaaatgccatgcatagctggggttttttcgtttttctttcctggatgcccatctacttcaactccgtgaggctcaatat

Protein Analysis

115

Amino Acids

13.14

Weight (kDa)

10.09

Isoelectric Point (pI)

57.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 118, 245
AclWI GGATC 1 cut(s) 208
AdeI CACNNNGTG 1 cut(s) 29
AfaI GTAC 1 cut(s) 109
AfiI CCNNNNNNNGG 1 cut(s) 183
AgsI TTSAA 1 cut(s) 328
AjnI CCWGG 2 cut(s) 251, 308
AluBI AGCT 1 cut(s) 285
AluI AGCT 1 cut(s) 285
AlwI GGATC 1 cut(s) 208
AoxI GGCC 1 cut(s) 255
AspLEI GCGC 1 cut(s) 231
AspS9I GGNCC 2 cut(s) 41, 255
AvaII GGWCC 1 cut(s) 41
BccI CCATC 1 cut(s) 326
BciT130I CCWGG 2 cut(s) 253, 310
BfoI RGCGCY 1 cut(s) 232
BmcAI AGTACT 1 cut(s) 109
Bme1390I CCNGG 2 cut(s) 253, 310
Bme18I GGWCC 1 cut(s) 41
BmgT120I GGNCC 2 cut(s) 41, 255
BmrFI CCNGG 2 cut(s) 253, 310
BmsI GCATC 1 cut(s) 303
BoxI GACNNNNGTC 1 cut(s) 120
BsaBI GATNNNNATC 1 cut(s) 317
BsaJI CCNNGG 1 cut(s) 252
BsaXI ACNNNNNCTCC 2 cut(s) 314, 344
Bsc4I CCNNNNNNNGG 1 cut(s) 183
Bse8I GATNNNNATC 1 cut(s) 317
BseBI CCWGG 2 cut(s) 253, 310
BseDI CCNNGG 1 cut(s) 252
BseGI GGATG 1 cut(s) 318
BseJI GATNNNNATC 1 cut(s) 317
BseLI CCNNNNNNNGG 1 cut(s) 183
BseMII CTCAG 1 cut(s) 140
BseYI CCCAGC 1 cut(s) 285
BshFI GGCC 1 cut(s) 257
BslI CCNNNNNNNGG 1 cut(s) 183
BsnI GGCC 1 cut(s) 257
Bsp143I GATC 1 cut(s) 213
BspACI CCGC 2 cut(s) 118, 245
BspANI GGCC 1 cut(s) 257
BspCNI CTCAG 1 cut(s) 139
BspPI GGATC 1 cut(s) 208
BssECI CCNNGG 1 cut(s) 252
BssMI GATC 1 cut(s) 213
Bst2UI CCWGG 2 cut(s) 253, 310
BstC8I GCNNGC 1 cut(s) 233
BstDEI CTNAG 2 cut(s) 126, 198
BstF5I GGATG 1 cut(s) 318
BstH2I RGCGCY 1 cut(s) 232
BstHHI GCGC 1 cut(s) 231
BstKTI GATC 1 cut(s) 216
BstMBI GATC 1 cut(s) 213
BstNI CCWGG 2 cut(s) 253, 310
BstPAI GACNNNNGTC 1 cut(s) 120
BstSCI CCNGG 2 cut(s) 251, 308
BsuRI GGCC 1 cut(s) 257
BtsCI GGATG 1 cut(s) 318
Cac8I GCNNGC 1 cut(s) 233
CfoI GCGC 1 cut(s) 231
Cfr13I GGNCC 2 cut(s) 41, 255
Csp6I GTAC 1 cut(s) 108
CviAII CATG 2 cut(s) 19, 277
CviJI RGCY 3 cut(s) 257, 285, 340
CviKI_1 RGCY 3 cut(s) 257, 285, 340
CviQI GTAC 1 cut(s) 108
DdeI CTNAG 2 cut(s) 126, 198
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
DraIII CACNNNGTG 1 cut(s) 29
Eco32I GATATC 1 cut(s) 132
Eco47I GGWCC 1 cut(s) 41
EcoRII CCWGG 2 cut(s) 251, 308
EcoRV GATATC 1 cut(s) 132
EcoT22I ATGCAT 1 cut(s) 282
FaeI CATG 2 cut(s) 22, 280
FaiI YATR 6 cut(s) 20, 88, 141, 155, 278, 282
FatI CATG 2 cut(s) 18, 276
FokI GGATG 1 cut(s) 325
GlaI GCGC 1 cut(s) 230
GsaI CCCAGC 1 cut(s) 289
HaeII RGCGCY 1 cut(s) 232
HaeIII GGCC 1 cut(s) 257
HhaI GCGC 1 cut(s) 231
Hin1II CATG 2 cut(s) 22, 280
Hin6I GCGC 1 cut(s) 229
HinP1I GCGC 1 cut(s) 229
HinfI GANTC 1 cut(s) 13
Hpy188I TCNGA 2 cut(s) 12, 129
Hpy188III TCNNGA 2 cut(s) 66, 113
HpyCH4V TGCA 3 cut(s) 98, 269, 280
HpyF3I CTNAG 2 cut(s) 126, 198
Hsp92II CATG 2 cut(s) 22, 280
HspAI GCGC 1 cut(s) 229
Kzo9I GATC 1 cut(s) 213
LpnPI CCDG 9 cut(s) 51, 126, 167, 211, 238, 265, 271, 295, 322
LweI GCATC 1 cut(s) 303
MaeIII GTNAC 1 cut(s) 21
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MluCI AATT 1 cut(s) 143
MnlI CCTC 4 cut(s) 135, 159, 228, 330
Mph1103I ATGCAT 1 cut(s) 282
MseI TTAA 1 cut(s) 260
MspR9I CCNGG 2 cut(s) 253, 310
MvaI CCWGG 2 cut(s) 253, 310
NdeII GATC 1 cut(s) 213
NlaIII CATG 2 cut(s) 22, 280
NmuCI GTSAC 1 cut(s) 21
NsiI ATGCAT 1 cut(s) 282
PfeI GAWTC 1 cut(s) 13
PfoI TCCNGGA 1 cut(s) 308
PshAI GACNNNNGTC 1 cut(s) 120
Psp6I CCWGG 2 cut(s) 251, 308
PspFI CCCAGC 1 cut(s) 285
PspGI CCWGG 2 cut(s) 251, 308
PspPI GGNCC 2 cut(s) 41, 255
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
SaqAI TTAA 1 cut(s) 260
Sau3AI GATC 1 cut(s) 213
Sau96I GGNCC 2 cut(s) 41, 255
ScaI AGTACT 1 cut(s) 109
ScrFI CCNGG 2 cut(s) 253, 310
SetI ASST 4 cut(s) 31, 199, 254, 287
SfaNI GCATC 1 cut(s) 303
SinI GGWCC 1 cut(s) 41
Sse9I AATT 1 cut(s) 143
SsiI CCGC 2 cut(s) 118, 245
StyD4I CCNGG 2 cut(s) 251, 308
TasI AATT 1 cut(s) 143
TatI WGTACW 1 cut(s) 107
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 260
Tru9I TTAA 1 cut(s) 260
TseFI GTSAC 1 cut(s) 21
Tsp45I GTSAC 1 cut(s) 21
TspDTI ATGAA 1 cut(s) 156
TspGWI ACGGA 1 cut(s) 322
VpaK11BI GGWCC 1 cut(s) 41
ZrmI AGTACT 1 cut(s) 109
Zsp2I ATGCAT 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.