Rmu_co8025518.1_g000001

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8025518.1
N/A
Physical Location & Seq
Reverse (-)
2 .. 189
188 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8025518.1_g000001.1.cds

Sequence Viewer

Length: 188 bp
atggtaatagtgggggagtttgttggaggggctgctctaggtgcagcattcggcactctctttgatgtggttaaggaagcgttggagaaatctgccatgtttaaacccttactcaagaccattaaatccactcttgattctttgcaaccgctgatccaacagatagaaatgcacaatgctgaattgaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.66

Weight (kDa)

5.09

Isoelectric Point (pI)

32.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AclWI GGATC 1 cut(s) 148
AgsI TTSAA 1 cut(s) 187
AlwI GGATC 1 cut(s) 148
ApeKI GCWGC 2 cut(s) 32, 44
BbvI GCAGC 2 cut(s) 19, 56
BfaI CTAG 1 cut(s) 38
BisI GCNGC 2 cut(s) 33, 45
BlsI GCNGC 2 cut(s) 34, 46
BpuEI CTTGAG 1 cut(s) 98
BseXI GCAGC 2 cut(s) 19, 56
BsgI GTGCAG 1 cut(s) 63
BsmI GAATGC 1 cut(s) 47
Bsp143I GATC 1 cut(s) 153
BspACI CCGC 1 cut(s) 149
BspPI GGATC 1 cut(s) 148
BssMI GATC 1 cut(s) 153
BstKTI GATC 1 cut(s) 156
BstMBI GATC 1 cut(s) 153
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstV1I GCAGC 2 cut(s) 19, 56
CviAII CATG 1 cut(s) 97
CviJI RGCY 1 cut(s) 32
CviKI_1 RGCY 1 cut(s) 32
DpnI GATC 1 cut(s) 155
DpnII GATC 1 cut(s) 153
DraI TTTAAA 1 cut(s) 103
FaeI CATG 1 cut(s) 100
FaiI YATR 1 cut(s) 98
FatI CATG 1 cut(s) 96
Fnu4HI GCNGC 2 cut(s) 33, 45
Fsp4HI GCNGC 2 cut(s) 33, 45
FspBI CTAG 1 cut(s) 38
GluI GCNGC 2 cut(s) 33, 45
Hin1II CATG 1 cut(s) 100
HinfI GANTC 1 cut(s) 137
Hpy188III TCNNGA 2 cut(s) 115, 134
HpyCH4V TGCA 3 cut(s) 44, 145, 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
Hsp92II CATG 1 cut(s) 100
Kzo9I GATC 1 cut(s) 153
Lsp1109I GCAGC 2 cut(s) 19, 56
MaeI CTAG 1 cut(s) 38
MalI GATC 1 cut(s) 155
MboI GATC 1 cut(s) 153
MluCI AATT 1 cut(s) 182
MmeI TCCRAC 3 cut(s) 4, 63, 181
MnlI CCTC 1 cut(s) 20
MseI TTAA 3 cut(s) 72, 102, 123
MspA1I CMGCKG 1 cut(s) 151
MssI GTTTAAAC 1 cut(s) 103
Mva1269I GAATGC 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 41
NdeII GATC 1 cut(s) 153
NlaIII CATG 1 cut(s) 100
PctI GAATGC 1 cut(s) 47
PfeI GAWTC 1 cut(s) 137
PkrI GCNGC 2 cut(s) 34, 46
PmeI GTTTAAAC 1 cut(s) 103
SaqAI TTAA 3 cut(s) 72, 102, 123
SatI GCNGC 2 cut(s) 33, 45
Sau3AI GATC 1 cut(s) 153
SetI ASST 1 cut(s) 43
SgeI CNNG 4 cut(s) 50, 109, 127, 146
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
Sse9I AATT 1 cut(s) 182
SsiI CCGC 1 cut(s) 149
SspMI CTAG 1 cut(s) 38
TasI AATT 1 cut(s) 182
TfiI GAWTC 1 cut(s) 137
Tru1I TTAA 3 cut(s) 72, 102, 123
Tru9I TTAA 3 cut(s) 72, 102, 123
TseI GCWGC 2 cut(s) 32, 44
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.