Rmu_co8028862.1_g000001
NAC Family

NAC domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8028862.1
N/A
Physical Location & Seq
Forward (+)
1 .. 545
545 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8028862.1_g000001.1.cds

Sequence Viewer

Length: 318 bp
gagcttgataacctgattcattctggaaatacaagtaccaaacagaagcttgatattctgaattctagaaatgcaaatgctacagaagagcgtgataatattcctcattctggaaatgcgaatgctacagatcattttaatagaagtgatatttatagagatttagcagacttgggcaacttgggtagagttgaagacgggtataatttttcgagtatgcatggttctctgtataccatggacgagattttcgagctagttgatcttgacaaaccgttgaactgcgatacttccatgtataatttaccatcttcatag

Protein Analysis

105

Amino Acids

11.77

Weight (kDa)

4.49

Isoelectric Point (pI)

35.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 233
AcsI RAATTY 1 cut(s) 61
AfaI GTAC 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 2 cut(s) 194, 280
AluBI AGCT 3 cut(s) 4, 49, 256
AluI AGCT 3 cut(s) 4, 49, 256
ApoI RAATTY 1 cut(s) 61
ArsI GACNNNNNNTTYG 2 cut(s) 233, 265
BbsI GAAGAC 1 cut(s) 201
BccI CCATC 1 cut(s) 316
BfaI CTAG 2 cut(s) 66, 257
BfmI CTRYAG 2 cut(s) 81, 126
BpiI GAAGAC 1 cut(s) 201
BsaJI CCNNGG 1 cut(s) 237
Bsc4I CCNNNNNNNGG 1 cut(s) 110
BseDI CCNNGG 1 cut(s) 237
BseLI CCNNNNNNNGG 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 110
BsmI GAATGC 1 cut(s) 127
Bsp143I GATC 2 cut(s) 130, 262
Bsp19I CCATGG 1 cut(s) 237
BspQI GCTCTTC 1 cut(s) 81
BssECI CCNNGG 1 cut(s) 237
BssMI GATC 2 cut(s) 130, 262
BssNAI GTATAC 1 cut(s) 234
BssT1I CCWWGG 1 cut(s) 237
Bst1107I GTATAC 1 cut(s) 234
Bst4CI ACNGT 1 cut(s) 276
Bst6I CTCTTC 1 cut(s) 81
BstDSI CCRYGG 1 cut(s) 237
BstKTI GATC 2 cut(s) 133, 265
BstMBI GATC 2 cut(s) 130, 262
BstSFI CTRYAG 2 cut(s) 81, 126
BstV2I GAAGAC 1 cut(s) 201
BstZ17I GTATAC 1 cut(s) 234
BtgI CCRYGG 1 cut(s) 237
Csp6I GTAC 1 cut(s) 36
CviAII CATG 3 cut(s) 221, 238, 295
CviJI RGCY 3 cut(s) 4, 49, 256
CviKI_1 RGCY 3 cut(s) 4, 49, 256
CviQI GTAC 1 cut(s) 36
DpnI GATC 2 cut(s) 132, 264
DpnII GATC 2 cut(s) 130, 262
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 237
EcoRI GAATTC 1 cut(s) 61
EcoT14I CCWWGG 1 cut(s) 237
EcoT22I ATGCAT 1 cut(s) 222
ErhI CCWWGG 1 cut(s) 237
FaeI CATG 3 cut(s) 224, 241, 298
FaiI YATR 9 cut(s) 156, 204, 218, 222, 234, 239, 296, 300, 316
FatI CATG 3 cut(s) 220, 237, 294
FblI GTMKAC 1 cut(s) 233
FspBI CTAG 2 cut(s) 66, 257
Hin1II CATG 3 cut(s) 224, 241, 298
HindIII AAGCTT 1 cut(s) 47
HinfI GANTC 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 234
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 4 cut(s) 24, 66, 111, 266
Hpy8I GTNNAC 1 cut(s) 234
HpyCH4III ACNGT 1 cut(s) 276
HpyCH4V TGCA 2 cut(s) 74, 220
Hsp92II CATG 3 cut(s) 224, 241, 298
Kzo9I GATC 2 cut(s) 130, 262
LguI GCTCTTC 1 cut(s) 81
LpnPI CCDG 3 cut(s) 9, 26, 96
MaeI CTAG 2 cut(s) 66, 257
MalI GATC 2 cut(s) 132, 264
MboI GATC 2 cut(s) 130, 262
MboII GAAGA 3 cut(s) 98, 206, 303
MluCI AATT 3 cut(s) 61, 205, 301
MnlI CCTC 1 cut(s) 114
Mph1103I ATGCAT 1 cut(s) 222
MseI TTAA 1 cut(s) 138
Mva1269I GAATGC 1 cut(s) 127
NcoI CCATGG 1 cut(s) 237
NdeII GATC 2 cut(s) 130, 262
NlaIII CATG 3 cut(s) 224, 241, 298
NsiI ATGCAT 1 cut(s) 222
PciSI GCTCTTC 1 cut(s) 81
PcsI WCGNNNNNNNCGW 1 cut(s) 249
PctI GAATGC 1 cut(s) 127
PfeI GAWTC 1 cut(s) 16
PsrI GAACNNNNNNTAC 2 cut(s) 208, 240
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SapI GCTCTTC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 2 cut(s) 130, 262
SetI ASST 4 cut(s) 6, 15, 51, 258
SfcI CTRYAG 2 cut(s) 81, 126
Sse9I AATT 3 cut(s) 61, 205, 301
SspI AATATT 1 cut(s) 100
SspMI CTAG 2 cut(s) 66, 257
StyI CCWWGG 1 cut(s) 237
TaaI ACNGT 1 cut(s) 276
TaqI TCGA 2 cut(s) 212, 252
TasI AATT 3 cut(s) 61, 205, 301
TfiI GAWTC 1 cut(s) 16
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspDTI ATGAA 2 cut(s) 8, 303
XapI RAATTY 1 cut(s) 61
XbaI TCTAGA 1 cut(s) 65
XmiI GTMKAC 1 cut(s) 233
XspI CTAG 2 cut(s) 66, 257
Zsp2I ATGCAT 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.