Rmu_co8088292.1_g000001
WRKY Family

WRKY transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8088292.1
N/A
Physical Location & Seq
Reverse (-)
1 .. 446
446 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8088292.1_g000001.1.cds

Sequence Viewer

Length: 417 bp
atggctggaaacgaagaagaacaccggcagccgccgtccacgtcgtcatctcgtcctccgcatcccacgattactctgccgccgcggactagttttgagaccatgtttaacaacaactccggaacaggcgggaatactggggcgggcttggggttcagtccggggccgatgactctggtttcgagcttcttctctgatggggaagactgcaagtcgttttctcagctgctggctggagccatgctgtctccggcggacagggcggcgtttccgccgcttgaagacaggaattccggggatgacagcagtgatttccggttcaagaatggaacggcgggtatgtcgattggaccgctgtcgccgatgtttccggctggtttcctcgactcgccgggaggactattctcgcccggacag

Protein Analysis

139

Amino Acids

14.45

Weight (kDa)

4.64

Isoelectric Point (pI)

55.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 85
AccIII TCCGGA 1 cut(s) 119
AcsI RAATTY 1 cut(s) 289
AgsI TTSAA 2 cut(s) 281, 322
AhdI GACNNNNNGTC 1 cut(s) 211
AhlI ACTAGT 1 cut(s) 89
AjiI CACGTC 1 cut(s) 42
AluBI AGCT 2 cut(s) 186, 226
AluI AGCT 2 cut(s) 186, 226
Alw26I GTCTC 2 cut(s) 92, 252
AlwNI CAGNNNCTG 1 cut(s) 229
Aor13HI TCCGGA 1 cut(s) 119
AoxI GGCC 1 cut(s) 164
ApeKI GCWGC 2 cut(s) 28, 226
ApoI RAATTY 1 cut(s) 289
ArsI GACNNNNNNTTYG 2 cut(s) 163, 195
AspS9I GGNCC 2 cut(s) 164, 350
AsuC2I CCSGG 4 cut(s) 162, 295, 393, 411
AvaII GGWCC 1 cut(s) 350
BbsI GAAGAC 2 cut(s) 210, 288
BbvI GCAGC 2 cut(s) 40, 213
BccI CCATC 1 cut(s) 191
BceAI ACGGC 2 cut(s) 19, 348
BcgI CGANNNNNNTGC 2 cut(s) 58, 92
BcnI CCSGG 4 cut(s) 162, 295, 393, 411
BcoDI GTCTC 2 cut(s) 92, 252
BcuI ACTAGT 1 cut(s) 89
BfaI CTAG 1 cut(s) 90
BisI GCNGC 7 cut(s) 29, 32, 80, 83, 227, 264, 275
BlsI GCNGC 7 cut(s) 30, 33, 81, 84, 228, 265, 276
Bme1390I CCNGG 4 cut(s) 162, 295, 393, 411
Bme18I GGWCC 1 cut(s) 350
BmeRI GACNNNNNGTC 1 cut(s) 211
BmgBI CACGTC 1 cut(s) 42
BmgT120I GGNCC 2 cut(s) 164, 350
BmiI GGNNCC 2 cut(s) 165, 238
BmrFI CCNGG 4 cut(s) 162, 295, 393, 411
BmrI ACTGGG 1 cut(s) 147
BmsI GCATC 1 cut(s) 70
BmuI ACTGGG 1 cut(s) 147
BoxI GACNNNNGTC 1 cut(s) 355
BpiI GAAGAC 2 cut(s) 210, 288
BpmI CTGGAG 1 cut(s) 255
BpuMI CCSGG 4 cut(s) 162, 295, 393, 411
BsaI GGTCTC 1 cut(s) 92
BsaJI CCNNGG 3 cut(s) 83, 161, 294
BsaWI WCCGGW 2 cut(s) 119, 315
BsaXI ACNNNNNCTCC 2 cut(s) 101, 131
Bse118I RCCGGY 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 142
BseAI TCCGGA 1 cut(s) 119
BseDI CCNNGG 3 cut(s) 83, 161, 294
BseGI GGATG 2 cut(s) 61, 304
BseMII CTCAG 1 cut(s) 236
BseNI ACTGG 1 cut(s) 142
BseXI GCAGC 2 cut(s) 40, 213
Bsh1236I CGCG 1 cut(s) 85
BshFI GGCC 1 cut(s) 166
BsiSI CCGG 9 cut(s) 25, 120, 161, 251, 294, 316, 371, 392, 411
BsmAI GTCTC 2 cut(s) 92, 252
BsnI GGCC 1 cut(s) 166
Bso31I GGTCTC 1 cut(s) 92
Bsp13I TCCGGA 1 cut(s) 119
BspANI GGCC 1 cut(s) 166
BspCNI CTCAG 1 cut(s) 235
BspEI TCCGGA 1 cut(s) 119
BspFNI CGCG 1 cut(s) 85
BspLI GGNNCC 2 cut(s) 165, 238
BspTNI GGTCTC 1 cut(s) 92
BsrFI RCCGGY 1 cut(s) 24
BsrI ACTGG 1 cut(s) 142
BssAI RCCGGY 1 cut(s) 24
BssECI CCNNGG 3 cut(s) 83, 161, 294
BstC8I GCNNGC 2 cut(s) 145, 231
BstDEI CTNAG 1 cut(s) 222
BstDSI CCRYGG 1 cut(s) 83
BstF5I GGATG 2 cut(s) 61, 304
BstFNI CGCG 1 cut(s) 85
BstMAI GTCTC 2 cut(s) 92, 252
BstMWI GCNNNNNNNGC 1 cut(s) 260
BstPAI GACNNNNGTC 1 cut(s) 355
BstSCI CCNGG 4 cut(s) 160, 293, 391, 409
BstUI CGCG 1 cut(s) 85
BstV1I GCAGC 2 cut(s) 40, 213
BstV2I GAAGAC 2 cut(s) 210, 288
BsuRI GGCC 1 cut(s) 166
BtgI CCRYGG 1 cut(s) 83
BtrI CACGTC 1 cut(s) 42
BtsCI GGATG 2 cut(s) 61, 304
BtsI GCAGTG 1 cut(s) 313
BtsIMutI CAGTG 1 cut(s) 313
Cac8I GCNNGC 2 cut(s) 145, 231
CaiI CAGNNNCTG 1 cut(s) 229
Cfr10I RCCGGY 1 cut(s) 24
Cfr13I GGNCC 2 cut(s) 164, 350
Cfr42I CCGCGG 1 cut(s) 86
CviAII CATG 2 cut(s) 103, 241
CviJI RGCY 9 cut(s) 5, 31, 147, 166, 186, 226, 233, 239, 374
CviKI_1 RGCY 9 cut(s) 5, 31, 147, 166, 186, 226, 233, 239, 374
DdeI CTNAG 1 cut(s) 222
DriI GACNNNNNGTC 1 cut(s) 211
Eam1105I GACNNNNNGTC 1 cut(s) 211
EciI GGCGGA 2 cut(s) 261, 269
Eco31I GGTCTC 1 cut(s) 92
Eco47I GGWCC 1 cut(s) 350
EcoRI GAATTC 1 cut(s) 289
FaeI CATG 2 cut(s) 106, 244
FaiI YATR 3 cut(s) 104, 242, 341
FatI CATG 2 cut(s) 102, 240
FauI CCCGC 3 cut(s) 122, 136, 328
Fnu4HI GCNGC 7 cut(s) 29, 32, 80, 83, 227, 264, 275
FokI GGATG 2 cut(s) 48, 311
Fsp4HI GCNGC 7 cut(s) 29, 32, 80, 83, 227, 264, 275
FspBI CTAG 1 cut(s) 90
GluI GCNGC 7 cut(s) 29, 32, 80, 83, 227, 264, 275
GsuI CTGGAG 1 cut(s) 255
HaeIII GGCC 1 cut(s) 166
HapII CCGG 9 cut(s) 25, 120, 161, 251, 294, 316, 371, 392, 411
Hin1II CATG 2 cut(s) 106, 244
HinfI GANTC 2 cut(s) 172, 386
HpaII CCGG 9 cut(s) 25, 120, 161, 251, 294, 316, 371, 392, 411
Hpy166II GTNNAC 1 cut(s) 39
Hpy188I TCNGA 1 cut(s) 196
Hpy188III TCNNGA 2 cut(s) 120, 322
Hpy8I GTNNAC 1 cut(s) 39
Hpy99I CGWCG 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 41
HpyCH4V TGCA 1 cut(s) 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 260
HpyF3I CTNAG 1 cut(s) 222
HpySE526I ACGT 1 cut(s) 41
Hsp92II CATG 2 cut(s) 106, 244
Kpn2I TCCGGA 1 cut(s) 119
KspI CCGCGG 1 cut(s) 86
LmnI GCTCC 1 cut(s) 236
Lsp1109I GCAGC 2 cut(s) 40, 213
LweI GCATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 90
MaeII ACGT 1 cut(s) 41
MboII GAAGA 5 cut(s) 26, 29, 181, 215, 293
MluCI AATT 1 cut(s) 289
MlyI GAGTC 2 cut(s) 166, 380
MnlI CCTC 3 cut(s) 66, 389, 392
MroI TCCGGA 1 cut(s) 119
MseI TTAA 1 cut(s) 108
MspA1I CMGCKG 3 cut(s) 85, 226, 355
MspI CCGG 9 cut(s) 25, 120, 161, 251, 294, 316, 371, 392, 411
MspR9I CCNGG 4 cut(s) 162, 295, 393, 411
MvnI CGCG 1 cut(s) 85
MwoI GCNNNNNNNGC 1 cut(s) 260
NciI CCSGG 4 cut(s) 162, 295, 393, 411
NlaIII CATG 2 cut(s) 106, 244
NlaIV GGNNCC 2 cut(s) 165, 238
PkrI GCNGC 7 cut(s) 30, 33, 81, 84, 228, 265, 276
PleI GAGTC 2 cut(s) 166, 380
PpsI GAGTC 2 cut(s) 166, 380
PshAI GACNNNNGTC 1 cut(s) 355
PspN4I GGNNCC 2 cut(s) 165, 238
PspPI GGNCC 2 cut(s) 164, 350
PstNI CAGNNNCTG 1 cut(s) 229
PvuII CAGCTG 1 cut(s) 226
SacII CCGCGG 1 cut(s) 86
SaqAI TTAA 1 cut(s) 108
SatI GCNGC 7 cut(s) 29, 32, 80, 83, 227, 264, 275
Sau96I GGNCC 2 cut(s) 164, 350
SchI GAGTC 2 cut(s) 166, 380
ScrFI CCNGG 4 cut(s) 162, 295, 393, 411
SetI ASST 3 cut(s) 44, 188, 228
SfaNI GCATC 1 cut(s) 70
Sfr303I CCGCGG 1 cut(s) 86
SgrBI CCGCGG 1 cut(s) 86
SinI GGWCC 1 cut(s) 350
SpeI ACTAGT 1 cut(s) 89
Sse9I AATT 1 cut(s) 289
SspMI CTAG 1 cut(s) 90
StyD4I CCNGG 4 cut(s) 160, 293, 391, 409
TaiI ACGT 1 cut(s) 44
TaqI TCGA 3 cut(s) 182, 344, 384
TasI AATT 1 cut(s) 289
TauI GCSGC 5 cut(s) 34, 82, 85, 266, 277
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TscAI CASTG 1 cut(s) 313
TseI GCWGC 2 cut(s) 28, 226
TspRI CASTG 1 cut(s) 313
VpaK11BI GGWCC 1 cut(s) 350
XapI RAATTY 1 cut(s) 289
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.