Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8125386.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

70 .. 567

Gene Structure 498 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8125386.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 417 bp

atgaaatacgatgtttacagcttcggtgttctgcttctgcaaatcataagtggcaagagaagttcatgtttttatggcttagatggaaatttaaacattctagaacacgcatatgagttgtggagagaaggccaaggcatggatttcatagatccaaccctagatgattcgacttcgtcttgcaagctcttaagatgcatggaagtagccttgttatgtgtccaagaaaatccagtagatagaccgtccatgctggaggtttcttcgatgcttaagagcgaaactgcagtcgtcattagtcctaaaaagcctgctttctcagttcagaaggatgaggatgaggatcatatatataaattcagggaagaaatctattcagtcaatgatgcaacaatgtccgaaattgtgccccgatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko00520 ko01100 map00520 map01100

Pfam Domains

Protein Families

Glyco_hydro_18 Pkinase Pkinase_Tyr

Protein Analysis

138

Amino Acids

15.71

Weight (kDa)

4.63

Isoelectric Point (pI)

61.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	139
AclWI	GGATC	2 cut(s)	146, 351
AcsI	RAATTY	2 cut(s)	88, 356
AfiI	CCNNNNNNNGG	1 cut(s)	139
AflII	CTTAAG	2 cut(s)	190, 272
AluBI	AGCT	2 cut(s)	21, 187
AluI	AGCT	2 cut(s)	21, 187
AlwI	GGATC	2 cut(s)	146, 351
AoxI	GGCC	1 cut(s)	130
ApoI	RAATTY	2 cut(s)	88, 356
ArsI	GACNNNNNNTTYG	2 cut(s)	273, 305
BaeGI	GKGCMC	1 cut(s)	411
BccI	CCATC	1 cut(s)	77
BfaI	CTAG	2 cut(s)	101, 161
BfmI	CTRYAG	1 cut(s)	285
BfrI	CTTAAG	2 cut(s)	190, 272
BmsI	GCATC	3 cut(s)	185, 258, 376
BpmI	CTGGAG	1 cut(s)	275
BsaBI	GATNNNNATC	1 cut(s)	342
BsaJI	CCNNGG	1 cut(s)	133
Bsc4I	CCNNNNNNNGG	1 cut(s)	139
Bse1I	ACTGG	1 cut(s)	233
Bse8I	GATNNNNATC	1 cut(s)	342
BseDI	CCNNGG	1 cut(s)	133
BseGI	GGATG	2 cut(s)	337, 343
BseJI	GATNNNNATC	1 cut(s)	342
BseLI	CCNNNNNNNGG	1 cut(s)	139
BseMII	CTCAG	1 cut(s)	333
BseNI	ACTGG	1 cut(s)	233
BseSI	GKGCMC	1 cut(s)	411
BshFI	GGCC	1 cut(s)	132
BslI	CCNNNNNNNGG	1 cut(s)	139
BsnI	GGCC	1 cut(s)	132
Bsp1286I	GDGCHC	1 cut(s)	411
Bsp143I	GATC	2 cut(s)	151, 343
BspANI	GGCC	1 cut(s)	132
BspCNI	CTCAG	1 cut(s)	332
BspMAI	CTGCAG	1 cut(s)	289
BspPI	GGATC	2 cut(s)	146, 351
BspTI	CTTAAG	2 cut(s)	190, 272
BsrI	ACTGG	1 cut(s)	233
BssECI	CCNNGG	1 cut(s)	133
BssMI	GATC	2 cut(s)	151, 343
BssT1I	CCWWGG	1 cut(s)	133
Bst4CI	ACNGT	1 cut(s)	246
BstAFI	CTTAAG	2 cut(s)	190, 272
BstC8I	GCNNGC	2 cut(s)	185, 312
BstDEI	CTNAG	2 cut(s)	79, 319
BstF5I	GGATG	2 cut(s)	337, 343
BstKTI	GATC	2 cut(s)	154, 346
BstMBI	GATC	2 cut(s)	151, 343
BstSFI	CTRYAG	1 cut(s)	285
BstSLI	GKGCMC	1 cut(s)	411
BstX2I	RGATCY	1 cut(s)	151
BstYI	RGATCY	1 cut(s)	151
BsuRI	GGCC	1 cut(s)	132
BtsCI	GGATG	2 cut(s)	337, 343
Cac8I	GCNNGC	2 cut(s)	185, 312
CviAII	CATG	4 cut(s)	66, 139, 199, 250
CviJI	RGCY	6 cut(s)	21, 78, 132, 187, 209, 310
CviKI_1	RGCY	6 cut(s)	21, 78, 132, 187, 209, 310
DdeI	CTNAG	2 cut(s)	79, 319
DpnI	GATC	2 cut(s)	153, 345
DpnII	GATC	2 cut(s)	151, 343
DraI	TTTAAA	1 cut(s)	93
Eco130I	CCWWGG	1 cut(s)	133
EcoT14I	CCWWGG	1 cut(s)	133
EcoT22I	ATGCAT	1 cut(s)	200
ErhI	CCWWGG	1 cut(s)	133
FaeI	CATG	4 cut(s)	69, 142, 202, 253
FatI	CATG	4 cut(s)	65, 138, 198, 249
FauNDI	CATATG	1 cut(s)	112
FokI	GGATG	2 cut(s)	344, 350
FspBI	CTAG	2 cut(s)	101, 161
GsuI	CTGGAG	1 cut(s)	275
HaeIII	GGCC	1 cut(s)	132
Hin1II	CATG	4 cut(s)	69, 142, 202, 253
HinfI	GANTC	1 cut(s)	167
Hpy166II	GTNNAC	1 cut(s)	16
Hpy188I	TCNGA	2 cut(s)	327, 400
Hpy188III	TCNNGA	1 cut(s)	101
Hpy8I	GTNNAC	1 cut(s)	16
HpyAV	CCTTC	2 cut(s)	122, 322
HpyCH4III	ACNGT	1 cut(s)	246
HpyCH4V	TGCA	5 cut(s)	40, 183, 198, 287, 389
HpyF3I	CTNAG	2 cut(s)	79, 319
Hsp92II	CATG	4 cut(s)	69, 142, 202, 253
Kzo9I	GATC	2 cut(s)	151, 343
LpnPI	CCDG	4 cut(s)	239, 246, 324, 346
LweI	GCATC	3 cut(s)	185, 258, 376
MaeI	CTAG	2 cut(s)	101, 161
MalI	GATC	2 cut(s)	153, 345
MboI	GATC	2 cut(s)	151, 343
MboII	GAAGA	2 cut(s)	255, 377
MflI	RGATCY	1 cut(s)	151
MhlI	GDGCHC	1 cut(s)	411
MluCI	AATT	3 cut(s)	88, 356, 402
MmeI	TCCRAC	1 cut(s)	179
MnlI	CCTC	3 cut(s)	250, 328, 334
Mph1103I	ATGCAT	1 cut(s)	200
MseI	TTAA	3 cut(s)	92, 191, 273
MslI	CAYNNNNRTG	1 cut(s)	111
MspCI	CTTAAG	2 cut(s)	190, 272
NdeI	CATATG	1 cut(s)	112
NdeII	GATC	2 cut(s)	151, 343
NlaIII	CATG	4 cut(s)	69, 142, 202, 253
NsiI	ATGCAT	1 cut(s)	200
PfeI	GAWTC	1 cut(s)	167
PflFI	GACNNNGTC	1 cut(s)	175
PflMI	CCANNNNNTGG	1 cut(s)	139
PstI	CTGCAG	1 cut(s)	289
PsuI	RGATCY	1 cut(s)	151
PsyI	GACNNNGTC	1 cut(s)	175
RseI	CAYNNNNRTG	1 cut(s)	111
SaqAI	TTAA	3 cut(s)	92, 191, 273
Sau3AI	GATC	2 cut(s)	151, 343
SduI	GDGCHC	1 cut(s)	411
SetI	ASST	3 cut(s)	23, 189, 261
SfaNI	GCATC	3 cut(s)	185, 258, 376
SfcI	CTRYAG	1 cut(s)	285
SmiMI	CAYNNNNRTG	1 cut(s)	111
SmlI	CTYRAG	2 cut(s)	190, 272
SmoI	CTYRAG	2 cut(s)	190, 272
Sse9I	AATT	3 cut(s)	88, 356, 402
SspMI	CTAG	2 cut(s)	101, 161
StyI	CCWWGG	1 cut(s)	133
TaaI	ACNGT	1 cut(s)	246
TaqI	TCGA	2 cut(s)	170, 266
TasI	AATT	3 cut(s)	88, 356, 402
TfiI	GAWTC	1 cut(s)	167
Tru1I	TTAA	3 cut(s)	92, 191, 273
Tru9I	TTAA	3 cut(s)	92, 191, 273
TspDTI	ATGAA	3 cut(s)	17, 54, 136
Tth111I	GACNNNGTC	1 cut(s)	175
Van91I	CCANNNNNTGG	1 cut(s)	139
Vha464I	CTTAAG	2 cut(s)	190, 272
XapI	RAATTY	2 cut(s)	88, 356
XbaI	TCTAGA	1 cut(s)	100
XspI	CTAG	2 cut(s)	101, 161
Zsp2I	ATGCAT	1 cut(s)	200

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.