Rmu_co8132672.1_g000001
ERF Family

Belongs to the TRAFAC class dynamin-like GTPase superfamily. Dynamin Fzo YdjA family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8132672.1
N/A
Physical Location & Seq
Reverse (-)
1 .. 546
546 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8132672.1_g000001.1.cds

Sequence Viewer

Length: 210 bp
atggactacataaatacttcacatgctaattttattggtggaagtaaggccgttgagagtgcattgcaacaggtgaagtcctctcggattcctatgcctcttgccaggcaaaaggatggtgtagactctgacaaggcaccatcatctgaaagaagtttgaagtccagagcaattcttggcagacaagtgaatggaattttgcctgaccag

Protein Analysis

70

Amino Acids

7.57

Weight (kDa)

9.69

Isoelectric Point (pI)

53.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 136
AccI GTMKAC 1 cut(s) 123
AcsI RAATTY 1 cut(s) 195
AgsI TTSAA 1 cut(s) 160
AjnI CCWGG 1 cut(s) 104
AoxI GGCC 1 cut(s) 48
ApoI RAATTY 1 cut(s) 195
AsuHPI GGTGA 1 cut(s) 85
BanI GGYRCC 1 cut(s) 136
BccI CCATC 2 cut(s) 110, 148
BceAI ACGGC 1 cut(s) 35
BciT130I CCWGG 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 106
Bse3DI GCAATG 1 cut(s) 62
BseBI CCWGG 1 cut(s) 106
BseGI GGATG 1 cut(s) 121
BseMI GCAATG 1 cut(s) 62
BshFI GGCC 1 cut(s) 50
BshNI GGYRCC 1 cut(s) 136
BsnI GGCC 1 cut(s) 50
BspANI GGCC 1 cut(s) 50
BspLI GGNNCC 1 cut(s) 138
BspT107I GGYRCC 1 cut(s) 136
BsrDI GCAATG 1 cut(s) 62
Bst2UI CCWGG 1 cut(s) 106
BstF5I GGATG 1 cut(s) 121
BstNI CCWGG 1 cut(s) 106
BstNSI RCATGY 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 104
BsuRI GGCC 1 cut(s) 50
BtsCI GGATG 1 cut(s) 121
CviAII CATG 1 cut(s) 23
CviJI RGCY 1 cut(s) 50
CviKI_1 RGCY 1 cut(s) 50
EcoRII CCWGG 1 cut(s) 104
FaeI CATG 1 cut(s) 26
FaiI YATR 3 cut(s) 11, 24, 95
FatI CATG 1 cut(s) 22
FblI GTMKAC 1 cut(s) 123
FokI GGATG 1 cut(s) 128
HaeIII GGCC 1 cut(s) 50
Hin1II CATG 1 cut(s) 26
HinfI GANTC 2 cut(s) 88, 125
HphI GGTGA 1 cut(s) 85
Hpy166II GTNNAC 1 cut(s) 124
Hpy188I TCNGA 3 cut(s) 87, 130, 148
Hpy188III TCNNGA 1 cut(s) 165
Hpy8I GTNNAC 1 cut(s) 124
HpyCH4V TGCA 2 cut(s) 62, 67
Hsp92II CATG 1 cut(s) 26
LpnPI CCDG 4 cut(s) 56, 91, 118, 178
MluCI AATT 3 cut(s) 28, 171, 195
MlyI GAGTC 1 cut(s) 119
MnlI CCTC 2 cut(s) 91, 108
MspR9I CCNGG 1 cut(s) 106
MvaI CCWGG 1 cut(s) 106
NlaIII CATG 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 138
NspI RCATGY 1 cut(s) 26
PfeI GAWTC 1 cut(s) 88
PleI GAGTC 1 cut(s) 119
PpsI GAGTC 1 cut(s) 119
Psp6I CCWGG 1 cut(s) 104
PspGI CCWGG 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 138
SchI GAGTC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 106
SetI ASST 1 cut(s) 75
Sse9I AATT 3 cut(s) 28, 171, 195
StyD4I CCNGG 1 cut(s) 104
TasI AATT 3 cut(s) 28, 171, 195
TfiI GAWTC 1 cut(s) 88
XapI RAATTY 1 cut(s) 195
XceI RCATGY 1 cut(s) 26
XmiI GTMKAC 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.