Rmu_co8166992.1_g000001

disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8166992.1
N/A
Physical Location & Seq
Forward (+)
1 .. 512
512 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8166992.1_g000001.1.cds

Sequence Viewer

Length: 215 bp
ctacttcaaagatcatggcggaagcgatagttaacgtactcctagagggttttacaacgatcaccaacaaagtcctcgaagagctaaatctggtcattcgagttactatagaagtcaaaaatctcacccacactctcaaagctattcaagctgtgctcgaggatgcagagcagagtcgaagtgatggaggccagtgtgggaagttggccgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

70

Amino Acids

7.61

Weight (kDa)

5.05

Isoelectric Point (pI)

35.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 19
AcoI YGGCCR 1 cut(s) 206
AfaI GTAC 1 cut(s) 38
AgsI TTSAA 2 cut(s) 8, 148
AluBI AGCT 3 cut(s) 84, 142, 151
AluI AGCT 3 cut(s) 84, 142, 151
Alw21I GWGCWC 1 cut(s) 158
Ama87I CYCGRG 1 cut(s) 157
AoxI GGCC 2 cut(s) 189, 206
AsuHPI GGTGA 2 cut(s) 54, 117
AvaI CYCGRG 1 cut(s) 157
Bbv12I GWGCWC 1 cut(s) 158
BccI CCATC 1 cut(s) 178
BfaI CTAG 1 cut(s) 43
BfmI CTRYAG 1 cut(s) 107
BmeT110I CYCGRG 1 cut(s) 157
BmsI GCATC 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 192
BseGI GGATG 1 cut(s) 168
BseNI ACTGG 1 cut(s) 192
BshFI GGCC 2 cut(s) 191, 208
BsiHKAI GWGCWC 1 cut(s) 158
BsiHKCI CYCGRG 1 cut(s) 157
BsnI GGCC 2 cut(s) 191, 208
BsoBI CYCGRG 1 cut(s) 157
Bsp1286I GDGCHC 1 cut(s) 158
Bsp143I GATC 2 cut(s) 11, 59
BspACI CCGC 1 cut(s) 19
BspANI GGCC 2 cut(s) 191, 208
BspQI GCTCTTC 1 cut(s) 74
BsrI ACTGG 1 cut(s) 192
BssMI GATC 2 cut(s) 11, 59
Bst6I CTCTTC 1 cut(s) 74
BstF5I GGATG 1 cut(s) 168
BstKTI GATC 2 cut(s) 14, 62
BstMBI GATC 2 cut(s) 11, 59
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstSFI CTRYAG 1 cut(s) 107
BsuRI GGCC 2 cut(s) 191, 208
BtsCI GGATG 1 cut(s) 168
BtsIMutI CAGTG 1 cut(s) 199
Csp6I GTAC 1 cut(s) 37
CviAII CATG 1 cut(s) 15
CviJI RGCY 5 cut(s) 84, 142, 151, 191, 208
CviKI_1 RGCY 5 cut(s) 84, 142, 151, 191, 208
CviQI GTAC 1 cut(s) 37
DpnI GATC 2 cut(s) 13, 61
DpnII GATC 2 cut(s) 11, 59
EaeI YGGCCR 1 cut(s) 206
Eam1104I CTCTTC 1 cut(s) 74
EarI CTCTTC 1 cut(s) 74
EciI GGCGGA 1 cut(s) 34
Eco88I CYCGRG 1 cut(s) 157
FaeI CATG 1 cut(s) 18
FaiI YATR 2 cut(s) 16, 109
FatI CATG 1 cut(s) 14
FokI GGATG 1 cut(s) 175
FspBI CTAG 1 cut(s) 43
HaeIII GGCC 2 cut(s) 191, 208
Hin1II CATG 1 cut(s) 18
HincII GTYRAC 1 cut(s) 33
HindII GTYRAC 1 cut(s) 33
HinfI GANTC 1 cut(s) 174
HpaI GTTAAC 1 cut(s) 33
HphI GGTGA 2 cut(s) 54, 117
Hpy166II GTNNAC 1 cut(s) 33
Hpy8I GTNNAC 1 cut(s) 33
HpyCH4IV ACGT 1 cut(s) 35
HpyCH4V TGCA 1 cut(s) 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
HpySE526I ACGT 1 cut(s) 35
Hsp92II CATG 1 cut(s) 18
KspAI GTTAAC 1 cut(s) 33
Kzo9I GATC 2 cut(s) 11, 59
LguI GCTCTTC 1 cut(s) 74
LpnPI CCDG 2 cut(s) 76, 205
LweI GCATC 1 cut(s) 153
MaeI CTAG 1 cut(s) 43
MaeII ACGT 1 cut(s) 35
MaeIII GTNAC 1 cut(s) 102
MalI GATC 2 cut(s) 13, 61
MboI GATC 2 cut(s) 11, 59
MboII GAAGA 1 cut(s) 91
MhlI GDGCHC 1 cut(s) 158
MlyI GAGTC 1 cut(s) 183
MnlI CCTC 4 cut(s) 39, 85, 153, 181
MseI TTAA 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 2 cut(s) 11, 59
NlaIII CATG 1 cut(s) 18
PaeR7I CTCGAG 1 cut(s) 157
PciSI GCTCTTC 1 cut(s) 74
PleI GAGTC 1 cut(s) 182
PpsI GAGTC 1 cut(s) 182
PspXI VCTCGAGB 1 cut(s) 157
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
SapI GCTCTTC 1 cut(s) 74
SaqAI TTAA 1 cut(s) 32
Sau3AI GATC 2 cut(s) 11, 59
SchI GAGTC 1 cut(s) 183
SduI GDGCHC 1 cut(s) 158
SetI ASST 4 cut(s) 38, 86, 144, 153
SfaNI GCATC 1 cut(s) 153
SfcI CTRYAG 1 cut(s) 107
Sfr274I CTCGAG 1 cut(s) 157
SgeI CNNG 9 cut(s) 27, 55, 88, 103, 112, 160, 169, 171, 204
SlaI CTCGAG 1 cut(s) 157
SmlI CTYRAG 1 cut(s) 157
SmoI CTYRAG 1 cut(s) 157
SsiI CCGC 1 cut(s) 19
SspMI CTAG 1 cut(s) 43
TaiI ACGT 1 cut(s) 38
TaqI TCGA 4 cut(s) 77, 99, 158, 177
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TscAI CASTG 1 cut(s) 199
TspRI CASTG 1 cut(s) 199
XhoI CTCGAG 1 cut(s) 157
XspI CTAG 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.