Rmu_co8196584.1_g000001

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8196584.1
N/A
Physical Location & Seq
Reverse (-)
2 .. 408
407 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8196584.1_g000001.1.cds

Sequence Viewer

Length: 407 bp
atggtctctagtgctagcaaaaatatagttggaatcgatgttcgtatagagacattgaagaattacttggctttgtggtctacaaatgacattttcaccatagggatttggggaatggggggcataggtaaaacaactcttgcagcagaatttttcaaaagatttcgtaaccaatttgatgctagcgcgtttgttgccaatgttagattggaagcgcggaaaggtcaattttacttagaaaaacttctttctgcatccttattggagagtgatgataatacatcgtccgttcagaaagggaatgaattcttaaggagaaggctaaagcaaaaggttcttatcattttggacgatgttgatgaattaaaacaaatagaagatttagcaggcggaaggccaggtgcatt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.07

Weight (kDa)

8.96

Isoelectric Point (pI)

36.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 80
AccII CGCG 2 cut(s) 188, 217
AciI CCGC 2 cut(s) 217, 390
AcsI RAATTY 2 cut(s) 149, 305
AflII CTTAAG 1 cut(s) 310
AgsI TTSAA 2 cut(s) 58, 157
AjnI CCWGG 1 cut(s) 397
AjuI GAANNNNNNNTTGG 2 cut(s) 50, 82
AloI GAACNNNNNNTCC 2 cut(s) 24, 56
Alw26I GTCTC 2 cut(s) 10, 44
AoxI GGCC 1 cut(s) 395
ApeKI GCWGC 1 cut(s) 143
ApoI RAATTY 2 cut(s) 149, 305
Asp700I GAANNNNTTC 2 cut(s) 243, 305
AspLEI GCGC 2 cut(s) 188, 217
AsuHPI GGTGA 1 cut(s) 88
AsuNHI GCTAGC 2 cut(s) 14, 182
BbvI GCAGC 1 cut(s) 155
BciT130I CCWGG 1 cut(s) 399
BcoDI GTCTC 2 cut(s) 10, 44
BfaI CTAG 3 cut(s) 9, 15, 183
BfrI CTTAAG 1 cut(s) 310
BisI GCNGC 1 cut(s) 144
BlsI GCNGC 1 cut(s) 145
Bme1390I CCNGG 1 cut(s) 399
BmrFI CCNGG 1 cut(s) 399
BmsI GCATC 2 cut(s) 169, 263
BmtI GCTAGC 2 cut(s) 18, 186
Bsa29I ATCGAT 1 cut(s) 36
BsaI GGTCTC 1 cut(s) 10
BseBI CCWGG 1 cut(s) 399
BseCI ATCGAT 1 cut(s) 36
BseGI GGATG 1 cut(s) 254
BseXI GCAGC 1 cut(s) 155
Bsh1236I CGCG 2 cut(s) 188, 217
BshFI GGCC 1 cut(s) 397
BshVI ATCGAT 1 cut(s) 36
BsmAI GTCTC 2 cut(s) 10, 44
BsnI GGCC 1 cut(s) 397
Bso31I GGTCTC 1 cut(s) 10
BspACI CCGC 2 cut(s) 217, 390
BspANI GGCC 1 cut(s) 397
BspDI ATCGAT 1 cut(s) 36
BspFNI CGCG 2 cut(s) 188, 217
BspOI GCTAGC 2 cut(s) 18, 186
BspTI CTTAAG 1 cut(s) 310
BspTNI GGTCTC 1 cut(s) 10
Bst2UI CCWGG 1 cut(s) 399
BstAFI CTTAAG 1 cut(s) 310
BstC8I GCNNGC 3 cut(s) 16, 184, 388
BstDEI CTNAG 1 cut(s) 235
BstF5I GGATG 1 cut(s) 254
BstFNI CGCG 2 cut(s) 188, 217
BstHHI GCGC 2 cut(s) 188, 217
BstMAI GTCTC 2 cut(s) 10, 44
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 399
BstSCI CCNGG 1 cut(s) 397
BstUI CGCG 2 cut(s) 188, 217
BstV1I GCAGC 1 cut(s) 155
Bsu15I ATCGAT 1 cut(s) 36
BsuRI GGCC 1 cut(s) 397
BsuTUI ATCGAT 1 cut(s) 36
BtsCI GGATG 1 cut(s) 254
Cac8I GCNNGC 3 cut(s) 16, 184, 388
CfoI GCGC 2 cut(s) 188, 217
ClaI ATCGAT 1 cut(s) 36
CviJI RGCY 3 cut(s) 71, 322, 397
CviKI_1 RGCY 3 cut(s) 71, 322, 397
DdeI CTNAG 1 cut(s) 235
EciI GGCGGA 1 cut(s) 405
Eco31I GGTCTC 1 cut(s) 10
EcoRI GAATTC 1 cut(s) 305
EcoRII CCWGG 1 cut(s) 397
FaiI YATR 4 cut(s) 26, 47, 101, 125
FalI AAGNNNNNCTT 2 cut(s) 50, 82
FblI GTMKAC 1 cut(s) 80
Fnu4HI GCNGC 1 cut(s) 144
FokI GGATG 1 cut(s) 241
Fsp4HI GCNGC 1 cut(s) 144
FspBI CTAG 3 cut(s) 9, 15, 183
GlaI GCGC 2 cut(s) 187, 216
GluI GCNGC 1 cut(s) 144
HaeIII GGCC 1 cut(s) 397
HhaI GCGC 2 cut(s) 188, 217
Hin6I GCGC 2 cut(s) 186, 215
HinP1I GCGC 2 cut(s) 186, 215
HinfI GANTC 1 cut(s) 33
HphI GGTGA 1 cut(s) 88
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 294
Hpy8I GTNNAC 1 cut(s) 81
HpyAV CCTTC 2 cut(s) 312, 387
HpyCH4V TGCA 3 cut(s) 143, 254, 404
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 1 cut(s) 235
HspAI GCGC 2 cut(s) 186, 215
LpnPI CCDG 2 cut(s) 372, 384
Lsp1109I GCAGC 1 cut(s) 155
LweI GCATC 2 cut(s) 169, 263
MaeI CTAG 3 cut(s) 9, 15, 183
MaeIII GTNAC 1 cut(s) 167
MboII GAAGA 2 cut(s) 70, 389
MluCI AATT 6 cut(s) 61, 149, 173, 227, 305, 362
MmeI TCCRAC 1 cut(s) 10
MroXI GAANNNNTTC 2 cut(s) 243, 305
MseI TTAA 2 cut(s) 311, 365
MspCI CTTAAG 1 cut(s) 310
MspR9I CCNGG 1 cut(s) 399
MvaI CCWGG 1 cut(s) 399
MvnI CGCG 2 cut(s) 188, 217
MwoI GCNNNNNNNGC 1 cut(s) 194
NheI GCTAGC 2 cut(s) 14, 182
PdmI GAANNNNTTC 2 cut(s) 243, 305
PfeI GAWTC 1 cut(s) 33
PkrI GCNGC 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 397
PspGI CCWGG 1 cut(s) 397
SaqAI TTAA 2 cut(s) 311, 365
SatI GCNGC 1 cut(s) 144
ScrFI CCNGG 1 cut(s) 399
SetI ASST 4 cut(s) 130, 226, 336, 403
SfaNI GCATC 2 cut(s) 169, 263
SgeI CNNG 8 cut(s) 21, 27, 79, 152, 195, 199, 228, 399
SmlI CTYRAG 1 cut(s) 310
SmoI CTYRAG 1 cut(s) 310
Sse9I AATT 6 cut(s) 61, 149, 173, 227, 305, 362
SsiI CCGC 2 cut(s) 217, 390
SspMI CTAG 3 cut(s) 9, 15, 183
StyD4I CCNGG 1 cut(s) 397
TaqI TCGA 1 cut(s) 36
TasI AATT 6 cut(s) 61, 149, 173, 227, 305, 362
TfiI GAWTC 1 cut(s) 33
Tru1I TTAA 2 cut(s) 311, 365
Tru9I TTAA 2 cut(s) 311, 365
TseI GCWGC 1 cut(s) 143
TspDTI ATGAA 2 cut(s) 318, 375
TspGWI ACGGA 1 cut(s) 277
Vha464I CTTAAG 1 cut(s) 310
XapI RAATTY 2 cut(s) 149, 305
XcmI CCANNNNNNNNNTGG 1 cut(s) 205
XmiI GTMKAC 1 cut(s) 80
XmnI GAANNNNTTC 2 cut(s) 243, 305
XspI CTAG 3 cut(s) 9, 15, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.