Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8223994.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 745

Gene Structure 744 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8223994.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 744 bp

ccaccagacgcagttcatacaatgctaccaaaacaaccggactattttagtccaaccctctgtctcttttgaagcaatatctggtgggaagaccttcttctgtggtctccggtccggtggctttagccttctttgctgggacaccagctctgttagcttcaatcctagacgtatataccacagtgacgacgtagcgttgactgatcttacggttggtgatgctcaagtttgcgccagagaggtcaactctagcacagtcaggtgctggagaggaggggctttgtttcactcaccaggggaggcattgaagttcaagacagtgacatctggaagtgggtttacatgtgggattttgatgaatggtagcagagtcctctgttggggaaatggtattggagctgagattcaaaaagggttcgagaatgtgttaatgtcaagcttaattgctggagagtctcatgcttgtggcttgaggaaaaatggaactttggtctgcaaagggaacaatgattccgggcaattgaatgtaccttatggggccaagttttcaggccttgcattgggagcaaattttacttgtgctataaggcaaagcaatggctatgttgtatgctggggacacagtgatgttgttggaaatgtttcgtttgagtcgattgttgcaggtttggattttgtatgtggactaacaagaggtaatctatcagtgatttgttggggaccaggatggtctagttctgaaaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0042802 GO:0042803 GO:0046983

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

Pkinase RCC1_2

Protein Analysis

247

Amino Acids

26.28

Weight (kDa)

8.0

Isoelectric Point (pI)

27.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	654
AcsI	RAATTY	1 cut(s)	569
AfaI	GTAC	1 cut(s)	529
AfiI	CCNNNNNNNGG	2 cut(s)	380, 560
AflIII	ACRYGT	1 cut(s)	342
AgsI	TTSAA	6 cut(s)	72, 161, 308, 314, 408, 524
AjnI	CCWGG	2 cut(s)	293, 722
AloI	GAACNNNNNNTCC	2 cut(s)	495, 527
AluBI	AGCT	4 cut(s)	148, 157, 399, 439
AluI	AGCT	4 cut(s)	148, 157, 399, 439
Alw26I	GTCTC	3 cut(s)	68, 111, 460
AlwNI	CAGNNNCTG	1 cut(s)	265
AoxI	GGCC	2 cut(s)	538, 551
ApoI	RAATTY	1 cut(s)	569
Asp700I	GAANNNNTTC	2 cut(s)	93, 641
AspLEI	GCGC	1 cut(s)	234
AspS9I	GGNCC	3 cut(s)	112, 538, 720
AsuC2I	CCSGG	1 cut(s)	515
AsuHPI	GGTGA	2 cut(s)	228, 283
AvaII	GGWCC	2 cut(s)	112, 720
BarI	GAAGNNNNNNTAC	2 cut(s)	323, 355
BbsI	GAAGAC	1 cut(s)	96
BccI	CCATC	1 cut(s)	721
BciT130I	CCWGG	2 cut(s)	295, 724
BcnI	CCSGG	1 cut(s)	515
BcoDI	GTCTC	3 cut(s)	68, 111, 460
BfaI	CTAG	3 cut(s)	166, 250, 733
BfuAI	ACCTGC	1 cut(s)	654
Bme1390I	CCNGG	3 cut(s)	295, 515, 724
Bme18I	GGWCC	2 cut(s)	112, 720
BmgT120I	GGNCC	3 cut(s)	112, 538, 720
BmiI	GGNNCC	2 cut(s)	539, 721
BmrFI	CCNGG	3 cut(s)	295, 515, 724
BmsI	GCATC	1 cut(s)	209
BpiI	GAAGAC	1 cut(s)	96
BplI	GAGNNNNNCTC	2 cut(s)	231, 263
BpmI	CTGGAG	2 cut(s)	287, 469
BpuEI	CTTGAG	2 cut(s)	208, 491
BpuMI	CCSGG	1 cut(s)	515
BsaI	GGTCTC	1 cut(s)	111
BsaJI	CCNNGG	1 cut(s)	294
BsaWI	WCCGGW	3 cut(s)	37, 109, 114
Bsc4I	CCNNNNNNNGG	2 cut(s)	380, 560
Bse3DI	GCAATG	1 cut(s)	602
BseBI	CCWGG	2 cut(s)	295, 724
BseDI	CCNNGG	1 cut(s)	294
BseGI	GGATG	1 cut(s)	732
BseLI	CCNNNNNNNGG	2 cut(s)	380, 560
BseMI	GCAATG	1 cut(s)	602
BseMII	CTCAG	1 cut(s)	391
BseRI	GAGGAG	1 cut(s)	286
BseYI	CCCAGC	2 cut(s)	136, 613
BshFI	GGCC	2 cut(s)	540, 553
BsiSI	CCGG	4 cut(s)	38, 110, 115, 514
BslFI	GGGAC	3 cut(s)	153, 631, 733
BslI	CCNNNNNNNGG	2 cut(s)	380, 560
BsmAI	GTCTC	3 cut(s)	68, 111, 460
BsmFI	GGGAC	3 cut(s)	153, 631, 733
BsnI	GGCC	2 cut(s)	540, 553
Bso31I	GGTCTC	1 cut(s)	111
Bsp143I	GATC	1 cut(s)	203
BspANI	GGCC	2 cut(s)	540, 553
BspCNI	CTCAG	1 cut(s)	392
BspLI	GGNNCC	2 cut(s)	539, 721
BspMI	ACCTGC	1 cut(s)	654
BspTNI	GGTCTC	1 cut(s)	111
BsrDI	GCAATG	1 cut(s)	602
BssECI	CCNNGG	1 cut(s)	294
BssMI	GATC	1 cut(s)	203
Bst2UI	CCWGG	2 cut(s)	295, 724
Bst4CI	ACNGT	5 cut(s)	183, 212, 257, 320, 624
BstDEI	CTNAG	1 cut(s)	400
BstF5I	GGATG	1 cut(s)	732
BstHHI	GCGC	1 cut(s)	234
BstKTI	GATC	1 cut(s)	206
BstMAI	GTCTC	3 cut(s)	68, 111, 460
BstMBI	GATC	1 cut(s)	203
BstMWI	GCNNNNNNNGC	3 cut(s)	133, 154, 564
BstNI	CCWGG	2 cut(s)	295, 724
BstNSI	RCATGY	1 cut(s)	346
BstSCI	CCNGG	3 cut(s)	293, 513, 722
BstV2I	GAAGAC	1 cut(s)	96
BsuRI	GGCC	2 cut(s)	540, 553
BtsCI	GGATG	1 cut(s)	732
BtsIMutI	CAGTG	4 cut(s)	188, 325, 629, 712
BveI	ACCTGC	1 cut(s)	654
CaiI	CAGNNNCTG	1 cut(s)	265
CfoI	GCGC	1 cut(s)	234
Cfr13I	GGNCC	3 cut(s)	112, 538, 720
CpoI	CGGWCCG	1 cut(s)	112
CseI	GACGC	1 cut(s)	17
Csp6I	GTAC	1 cut(s)	528
CspI	CGGWCCG	1 cut(s)	112
CviAII	CATG	2 cut(s)	343, 459
CviQI	GTAC	1 cut(s)	528
DdeI	CTNAG	1 cut(s)	400
DpnI	GATC	1 cut(s)	205
DpnII	GATC	1 cut(s)	203
Eco147I	AGGCCT	1 cut(s)	553
Eco31I	GGTCTC	1 cut(s)	111
Eco47I	GGWCC	2 cut(s)	112, 720
EcoRII	CCWGG	2 cut(s)	293, 722
FaeI	CATG	2 cut(s)	346, 462
FalI	AAGNNNNNCTT	2 cut(s)	81, 113
FaqI	GGGAC	3 cut(s)	153, 631, 733
FatI	CATG	2 cut(s)	342, 458
FokI	GGATG	1 cut(s)	739
FspBI	CTAG	3 cut(s)	166, 250, 733
GlaI	GCGC	1 cut(s)	233
GsaI	CCCAGC	2 cut(s)	140, 617
GsuI	CTGGAG	2 cut(s)	287, 469
HaeIII	GGCC	2 cut(s)	540, 553
HapII	CCGG	4 cut(s)	38, 110, 115, 514
HgaI	GACGC	1 cut(s)	17
HhaI	GCGC	1 cut(s)	234
Hin1II	CATG	2 cut(s)	346, 462
Hin6I	GCGC	1 cut(s)	232
HinP1I	GCGC	1 cut(s)	232
HincII	GTYRAC	2 cut(s)	199, 245
HindII	GTYRAC	2 cut(s)	199, 245
HindIII	AAGCTT	1 cut(s)	437
HinfI	GANTC	5 cut(s)	370, 404, 453, 510, 651
HpaII	CCGG	4 cut(s)	38, 110, 115, 514
HphI	GGTGA	2 cut(s)	228, 283
Hpy166II	GTNNAC	4 cut(s)	199, 245, 340, 684
Hpy188I	TCNGA	1 cut(s)	740
Hpy188III	TCNNGA	3 cut(s)	314, 328, 419
Hpy8I	GTNNAC	4 cut(s)	199, 245, 340, 684
Hpy99I	CGWCG	1 cut(s)	192
HpyAV	CCTTC	2 cut(s)	104, 138
HpyCH4III	ACNGT	5 cut(s)	183, 212, 257, 320, 624
HpyCH4IV	ACGT	2 cut(s)	170, 190
HpyCH4V	TGCA	3 cut(s)	496, 558, 663
HpyF10VI	GCNNNNNNNGC	3 cut(s)	133, 154, 564
HpyF3I	CTNAG	1 cut(s)	400
HpySE526I	ACGT	2 cut(s)	170, 190
Hsp92II	CATG	2 cut(s)	346, 462
HspAI	GCGC	1 cut(s)	232
Kzo9I	GATC	1 cut(s)	203
LmnI	GCTCC	2 cut(s)	396, 564
LweI	GCATC	1 cut(s)	209
MaeI	CTAG	3 cut(s)	166, 250, 733
MaeII	ACGT	2 cut(s)	170, 190
MaeIII	GTNAC	2 cut(s)	183, 320
MalI	GATC	1 cut(s)	205
MboI	GATC	1 cut(s)	203
MboII	GAAGA	2 cut(s)	89, 101
MfeI	CAATTG	1 cut(s)	519
MluCI	AATT	3 cut(s)	442, 519, 569
MlyI	GAGTC	3 cut(s)	379, 462, 660
MmeI	TCCRAC	2 cut(s)	77, 614
MnlI	CCTC	8 cut(s)	68, 233, 264, 267, 293, 384, 466, 687
MroXI	GAANNNNTTC	2 cut(s)	93, 641
MseI	TTAA	2 cut(s)	429, 441
MslI	CAYNNNNRTG	2 cut(s)	463, 625
MspI	CCGG	4 cut(s)	38, 110, 115, 514
MspR9I	CCNGG	3 cut(s)	295, 515, 724
MunI	CAATTG	1 cut(s)	519
MvaI	CCWGG	2 cut(s)	295, 724
MwoI	GCNNNNNNNGC	3 cut(s)	133, 154, 564
NciI	CCSGG	1 cut(s)	515
NdeII	GATC	1 cut(s)	203
NlaIII	CATG	2 cut(s)	346, 462
NlaIV	GGNNCC	2 cut(s)	539, 721
NmuCI	GTSAC	2 cut(s)	183, 320
NspI	RCATGY	1 cut(s)	346
PceI	AGGCCT	1 cut(s)	553
PciI	ACATGT	1 cut(s)	342
PcsI	WCGNNNNNNNCGW	1 cut(s)	651
PdmI	GAANNNNTTC	2 cut(s)	93, 641
PfeI	GAWTC	2 cut(s)	404, 510
PleI	GAGTC	3 cut(s)	378, 461, 659
PpsI	GAGTC	3 cut(s)	378, 461, 659
PscI	ACATGT	1 cut(s)	342
Psp6I	CCWGG	2 cut(s)	293, 722
PspFI	CCCAGC	2 cut(s)	136, 613
PspGI	CCWGG	2 cut(s)	293, 722
PspN4I	GGNNCC	2 cut(s)	539, 721
PspPI	GGNCC	3 cut(s)	112, 538, 720
PstNI	CAGNNNCTG	1 cut(s)	265
RsaI	GTAC	1 cut(s)	529
RsaNI	GTAC	1 cut(s)	528
RseI	CAYNNNNRTG	2 cut(s)	463, 625
Rsr2I	CGGWCCG	1 cut(s)	112
RsrII	CGGWCCG	1 cut(s)	112
SaqAI	TTAA	2 cut(s)	429, 441
Sau3AI	GATC	1 cut(s)	203
Sau96I	GGNCC	3 cut(s)	112, 538, 720
SchI	GAGTC	3 cut(s)	379, 462, 660
ScrFI	CCNGG	3 cut(s)	295, 515, 724
SfaNI	GCATC	1 cut(s)	209
SinI	GGWCC	2 cut(s)	112, 720
SmiMI	CAYNNNNRTG	2 cut(s)	463, 625
SmlI	CTYRAG	2 cut(s)	223, 470
SmoI	CTYRAG	2 cut(s)	223, 470
Sse9I	AATT	3 cut(s)	442, 519, 569
SseBI	AGGCCT	1 cut(s)	553
SspMI	CTAG	3 cut(s)	166, 250, 733
StuI	AGGCCT	1 cut(s)	553
StyD4I	CCNGG	3 cut(s)	293, 513, 722
TaaI	ACNGT	5 cut(s)	183, 212, 257, 320, 624
TaiI	ACGT	2 cut(s)	173, 193
TaqI	TCGA	2 cut(s)	418, 654
TasI	AATT	3 cut(s)	442, 519, 569
TfiI	GAWTC	2 cut(s)	404, 510
Tru1I	TTAA	2 cut(s)	429, 441
Tru9I	TTAA	2 cut(s)	429, 441
TscAI	CASTG	4 cut(s)	188, 325, 629, 712
TseFI	GTSAC	2 cut(s)	183, 320
Tsp45I	GTSAC	2 cut(s)	183, 320
TspDTI	ATGAA	2 cut(s)	5, 372
TspRI	CASTG	4 cut(s)	188, 325, 629, 712
VpaK11BI	GGWCC	2 cut(s)	112, 720
XapI	RAATTY	1 cut(s)	569
XceI	RCATGY	1 cut(s)	346
XmnI	GAANNNNTTC	2 cut(s)	93, 641
XspI	CTAG	3 cut(s)	166, 250, 733

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.