Rmu_co8224528.1_g000001

Tornado 1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8224528.1
N/A
Physical Location & Seq
Reverse (-)
1 .. 620
620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8224528.1_g000001.1.cds

Sequence Viewer

Length: 561 bp
atgtttcggagaaacagattcggaagagagtgcatatcagagctatctgaaattctgaagagaaatggagtgatcaaagaggtaatgtttactgaatcaaatgttgggtctgttggagctggatttcttgcttctgcccttaaagtgaatgatagcttggaagagttacagatatgggaagactctattggctccaagggagcagaggagctctcaaagatgattgaagtgaactcaacactgaagctgttgacaatatttgactcgaactcaatcacagcaaccccacttatctctgcggttttagcaaggaatagagctatggaagttcatgtgtggagtggagaaaatggcgaaaagagttctaaggtggttgagtttctacctgaaaatagcacactccgaatttacaggctcgacctttcaggtgcatgcagggttgcctgtgctcttggctggaactcaactgtcaagtcactcgacatgactggggtgcggttaaagtcaagatgggccaaggagtttcgatgggttttggagcaaaaccagagcctcaaagag

Protein Analysis

187

Amino Acids

20.93

Weight (kDa)

7.69

Isoelectric Point (pI)

47.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 299, 496
AcsI RAATTY 2 cut(s) 51, 405
AcuI CTGAAG 2 cut(s) 77, 263
AgsI TTSAA 1 cut(s) 227
AjuI GAANNNNNNNTTGG 6 cut(s) 87, 119, 140, 171, 172, 203
AluBI AGCT 6 cut(s) 43, 119, 156, 211, 247, 320
AluI AGCT 6 cut(s) 43, 119, 156, 211, 247, 320
Alw21I GWGCWC 2 cut(s) 213, 451
AoxI GGCC 1 cut(s) 513
ApoI RAATTY 2 cut(s) 51, 405
ArsI GACNNNNNNTTYG 2 cut(s) 92, 124
AspS9I GGNCC 1 cut(s) 513
BanII GRGCYC 1 cut(s) 213
BbsI GAAGAC 1 cut(s) 186
Bbv12I GWGCWC 2 cut(s) 213, 451
BccI CCATC 2 cut(s) 504, 522
BclI TGATCA 1 cut(s) 72
BmgT120I GGNCC 1 cut(s) 513
BmiI GGNNCC 1 cut(s) 193
BmrI ACTGGG 1 cut(s) 498
BmuI ACTGGG 1 cut(s) 498
BpiI GAAGAC 1 cut(s) 186
BplI GAGNNNNNCTC 2 cut(s) 197, 229
BsaJI CCNNGG 2 cut(s) 195, 516
Bse1I ACTGG 1 cut(s) 493
BseDI CCNNGG 2 cut(s) 195, 516
BseNI ACTGG 1 cut(s) 493
BseRI GAGGAG 1 cut(s) 221
BshFI GGCC 1 cut(s) 515
BsiHKAI GWGCWC 2 cut(s) 213, 451
BsnI GGCC 1 cut(s) 515
Bsp1286I GDGCHC 2 cut(s) 213, 451
Bsp143I GATC 1 cut(s) 72
BspACI CCGC 2 cut(s) 299, 496
BspANI GGCC 1 cut(s) 515
BspLI GGNNCC 1 cut(s) 193
BsrI ACTGG 1 cut(s) 493
BssECI CCNNGG 2 cut(s) 195, 516
BssMI GATC 1 cut(s) 72
BssT1I CCWWGG 2 cut(s) 195, 516
Bst4CI ACNGT 1 cut(s) 469
Bst6I CTCTTC 3 cut(s) 19, 53, 156
BstC8I GCNNGC 1 cut(s) 433
BstDEI CTNAG 1 cut(s) 366
BstKTI GATC 1 cut(s) 75
BstMBI GATC 1 cut(s) 72
BstMWI GCNNNNNNNGC 1 cut(s) 305
BstNSI RCATGY 1 cut(s) 435
BstV2I GAAGAC 1 cut(s) 186
BsuRI GGCC 1 cut(s) 515
BtsIMutI CAGTG 1 cut(s) 239
Cac8I GCNNGC 1 cut(s) 433
Cfr13I GGNCC 1 cut(s) 513
CviAII CATG 3 cut(s) 332, 432, 484
DdeI CTNAG 1 cut(s) 366
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
Eam1104I CTCTTC 3 cut(s) 19, 53, 156
EarI CTCTTC 3 cut(s) 19, 53, 156
Ecl136II GAGCTC 1 cut(s) 211
Eco130I CCWWGG 2 cut(s) 195, 516
Eco24I GRGCYC 1 cut(s) 213
Eco53kI GAGCTC 1 cut(s) 211
Eco57I CTGAAG 2 cut(s) 77, 263
EcoICRI GAGCTC 1 cut(s) 211
EcoT14I CCWWGG 2 cut(s) 195, 516
EcoT38I GRGCYC 1 cut(s) 213
ErhI CCWWGG 2 cut(s) 195, 516
FaeI CATG 3 cut(s) 335, 435, 487
FaiI YATR 6 cut(s) 35, 175, 323, 333, 433, 485
FatI CATG 3 cut(s) 331, 431, 483
FbaI TGATCA 1 cut(s) 72
FriOI GRGCYC 1 cut(s) 213
HaeIII GGCC 1 cut(s) 515
Hin1II CATG 3 cut(s) 335, 435, 487
HincII GTYRAC 1 cut(s) 252
HindII GTYRAC 1 cut(s) 252
HinfI GANTC 4 cut(s) 18, 95, 182, 263
Hpy166II GTNNAC 3 cut(s) 90, 232, 252
Hpy188I TCNGA 6 cut(s) 9, 23, 40, 49, 57, 404
Hpy188III TCNNGA 1 cut(s) 507
Hpy8I GTNNAC 3 cut(s) 90, 232, 252
HpyCH4III ACNGT 1 cut(s) 469
HpyCH4V TGCA 3 cut(s) 33, 431, 435
HpyF10VI GCNNNNNNNGC 1 cut(s) 305
HpyF3I CTNAG 1 cut(s) 366
Hsp92II CATG 3 cut(s) 335, 435, 487
Ksp22I TGATCA 1 cut(s) 72
Kzo9I GATC 1 cut(s) 72
LmnI GCTCC 5 cut(s) 116, 197, 200, 208, 538
LpnPI CCDG 8 cut(s) 105, 397, 399, 411, 421, 442, 457, 474
MaeIII GTNAC 2 cut(s) 165, 474
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MboII GAAGA 4 cut(s) 36, 70, 173, 191
MhlI GDGCHC 2 cut(s) 213, 451
MluCI AATT 2 cut(s) 51, 405
MlyI GAGTC 2 cut(s) 176, 257
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 2 cut(s) 73, 199
MseI TTAA 2 cut(s) 141, 500
MwoI GCNNNNNNNGC 1 cut(s) 305
NdeII GATC 1 cut(s) 72
NlaIII CATG 3 cut(s) 335, 435, 487
NlaIV GGNNCC 1 cut(s) 193
NmuCI GTSAC 1 cut(s) 474
NspI RCATGY 1 cut(s) 435
PaeI GCATGC 1 cut(s) 435
PfeI GAWTC 2 cut(s) 18, 95
PleI GAGTC 2 cut(s) 176, 257
PpsI GAGTC 2 cut(s) 176, 257
Psp124BI GAGCTC 1 cut(s) 213
PspN4I GGNNCC 1 cut(s) 193
PspPI GGNCC 1 cut(s) 513
SacI GAGCTC 1 cut(s) 213
SaqAI TTAA 2 cut(s) 141, 500
Sau3AI GATC 1 cut(s) 72
Sau96I GGNCC 1 cut(s) 513
SchI GAGTC 2 cut(s) 176, 257
SduI GDGCHC 2 cut(s) 213, 451
SphI GCATGC 1 cut(s) 435
Sse9I AATT 2 cut(s) 51, 405
SsiI CCGC 2 cut(s) 299, 496
SspI AATATT 1 cut(s) 258
SstI GAGCTC 1 cut(s) 213
StyI CCWWGG 2 cut(s) 195, 516
TaaI ACNGT 1 cut(s) 469
TaqI TCGA 4 cut(s) 266, 417, 480, 526
TasI AATT 2 cut(s) 51, 405
TfiI GAWTC 2 cut(s) 18, 95
Tru1I TTAA 2 cut(s) 141, 500
Tru9I TTAA 2 cut(s) 141, 500
TscAI CASTG 1 cut(s) 246
TseFI GTSAC 1 cut(s) 474
Tsp45I GTSAC 1 cut(s) 474
TspDTI ATGAA 1 cut(s) 320
TspRI CASTG 1 cut(s) 246
XapI RAATTY 2 cut(s) 51, 405
XceI RCATGY 1 cut(s) 435
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.